ORFeome > faim ORF1 – XORFeome v1.0

faim ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: faim
Gene ID: 6255884
Gene Page ID: 975717
ORF Xenbase ID: 17275041

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC097798
Original XGC clone length: 540

Human orthology & disease relationships

NCBI Entrez ID: 55179
Ensembl gene IDs: ENSG00000158234
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 204000,268000,601777,602875

Library Location

Plate ID: GDExl11089
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ838399
dbEST ID: 79656101
Trimmed Sequence: ATGACGGACCTGGTGGCCATGTGGGAAGTCTCCCTTAGTGATGGAATCCATAAGATTGAGTTTGAGCATGGCACAACTTCAGGGAAGCGAGTTGTGTATGTAGATGGGAAGGAGATTATCCGGAAGGATTGGATGTTCAAGTTGGTTGGGAAGGAGACATTCCCGGTGGGAGCCTCTCAGACGAAGGCCACCATTAATATTGATGCTGTTAGTGGCTTTGCCTATGAGTACACACTGGATATAAATGGCAAGAGCCTGAAGAAGTACATGGAGAATCGCTCAAAGACCACCAACACATGGGTGCTTCACCTAGACGGAGAGGACTGCCGGGTTGTGCTGGAGAAGGACACCATGGACGTTTGGTGCAACGGCAGAAACATGGAGACAGCGGGTGAGTTTGTGGATGATGGCACAGAAACACACTTCAGCATCGTGAATCACGATTGCTGCATCAAAGCTGTGAGTAGCGGGAAGCGAAGGGAAGGAATTATCCACACGCTCATTGTGGATGACCGGGAAATCCCAGAGAGCACAGAGTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACGGACCTGGTGGCCATGTGGGAAGTCTCCCTTAGTGATGGAATCCATAAGATTGAGTTTGAGCATGGCACAACTTCAGGGAAGCGAGTTGTGTATGTAGATGGGAAGGAGATTATCCGGAAGGATTGGATGTTCAAGTTGGTTGGGAAGGAGACATTCCCGGTGGGAGCCTCTCAGACGAAGGCCACCATTAATATTGATGCTGTTAGTGGCTTTGCCTATGAGTACACACTGGATATAAATGGCAAGAGCCTGAAGAAGTACATGGAGAATCGCTCAAAGACCACCAACACATGGGTGCTTCACCTAGACGGAGAGGACTGCCGGGTTGTGCTGGAGAAGGACACCATGGACGTTTGGTGCAACGGCAGAAACATGGAGACAGCGGGTGAGTTTGTGGATGATGGCACAGAAACACACTTCAGCATCGTGAATCACGATTGCTGCATCAAAGCTGTGAGTAGCGGGAAGCGAAGGGAAGGAATTATCCACACGCTCATTGTGGATGACCGGGAAATCCCAGAGAGCACAGAGTTGCCAACTTTCTTGTACAAATTTGGCATTATAAAAAAGCATTGCTTAATCATTTGTTTGCACCGAACAGGTCACTATCATTTCAAATTAAAATCATTATTTGGCCGTCCAGCTGATATCCCTTATAGTGAGTCTGGATACATTGTTCCTAGCCGGTTTAAAAAAAAAAAAAAAGAAACCAGAATCTCAAAACAACATAAAGTTAACAACCAGNGNGGGNAAGAAACNGCGGTCGCCGCCTCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGGACCTGGTGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838398
dbEST ID: 79656100
Trimmed Sequence: CTCTGTGCTCTCTGGGATTTCCCGGTCATCCACAATGAGCGTGTGGATAATTCCTTCCCTTCGCTTCCCGCTACTCACAGCTTTGATGCAGCAATCGTGATTCCCGATGCTGAAGTGTGTTTCTGTGCCATCATCCACAAACTCACCCGCTGTCTCCATGTTTCTGCCGTTGCACCAAACGTCCATGGTGTCCTTCTCCAGCACAACCCGGCAGTCCTCTCCGTCTAGGTGAAGCACCCATGTGTTGGTGGTCTTTGAGCGATTCTCCATGTACTTCTTCAGGCTCTTGCCATTTATATCCAGTGTGTACTCATAGGCAAAGCCACTAACAGCATCAATATTAATGGTGGCCTTCGTCTGAGAGGCTCCCGCCGGGAATGTCTCCTTCCCAACCCACTTGAACATCCAATCCTTCCGGATAATACCCTTACCATCGAACATACAGAAGTCGCTTCACTTAAGTTGGTGCCATGGCGCGAGCTCGATCTTATGGGATTCATCACAAAAGGAAGACTTCGACACGTGACCCGCTGGGGCCGTCAGTGGGCGCAACTTGATTAAACAAAGGGTGGGCGTGTGAAAACCCAATGGGTGGTCAGTTTATTGGGAGGGAAGGGGGGGGGGGGGGGGGGGGGANGAGTCGTTGGGAAAAAAAAAAAAAAAAAAAAAAGAAGGAAACAATAAAGGAAAGGCAAAAAACGGAGGGGAAGAAAAAGGCGCGGCCCCGGCTCGCCACC
Full Trace Sequence: GGGGGAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTGTGCTCTCTGGGATTTCCCGGTCATCCACAATGAGCGTGTGGATAATTCCTTCCCTTCGCTTCCCGCTACTCACAGCTTTGATGCAGCAATCGTGATTCCCGATGCTGAAGTGTGTTTCTGTGCCATCATCCACAAACTCACCCGCTGTCTCCATGTTTCTGCCGTTGCACCAAACGTCCATGGTGTCCTTCTCCAGCACAACCCGGCAGTCCTCTCCGTCTAGGTGAAGCACCCATGTGTTGGTGGTCTTTGAGCGATTCTCCATGTACTTCTTCAGGCTCTTGCCATTTATATCCAGTGTGTACTCATAGGCAAAGCCACTAACAGCATCAATATTAATGGTGGCCTTCGTCTGAGAGGCTCCCGCCGGGAATGTCTCCTTCCCAACCCACTTGAACATCCAATCCTTCCGGATAATACCCTTACCATCGAACATACAGAAGTCGCTTCACTTAAGTTGGTGCCATGGCGCGAGCTCGATCTTATGGGATTCATCACAAAAGGAAGACTTCGACACGTGACCCGCTGGGGCCGTCAGTGGGCGCAACTTGATTAAACAAAGGGTGGGCGTGTGAAAACCCAATGGGTGGTCAGTTTATTGGGAGGGAAGGGGGGGGGGGGGGGGGGGGGANGAGTCGTTGGGAAAAAAAAAAAAAAAAAAAAAAGAAGGAAACAATAAAGGAAAGGCAAAAAACGGAGGGGAAGAAAAAGGCGCGGCCCCGGCTCGCCACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTGTGCTCTCTGGGATT