ORFeome > fam101b ORF1 – XORFeome v1.0

fam101b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fam101b
Gene ID: 962751
Gene Page ID: 962745
ORF Xenbase ID: 17275059

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078580
Original XGC clone length: 708

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ839892
dbEST ID: 79657594
Trimmed Sequence: ATGGTTGGCAGACTGAACCTGCAGGATGTCCCTGATCTGCTGGACATGAAGAAGAAAGGTGAAAGAGTGTTGGACAGCCCTGAACTCTGGGCTCCCCCCCAGCCCCTGCCCCAGTAACTGGCACCTGTCTGCTGTGGCAACTGAGAAATCTCCTGAGCAAGACATCTCTGGGCACAATGCCCCAACAAATTTGGCCCTCTCGTTAAGCCTATCCAGCAGCTTCACACCAAGACTGTGCCCTTTATCGCTCGGAGAGGGTGTGGAGTTTGATCCGCTGCCACCAAAGGAGATAAGGTACACCTCATCAGTTAAATATGATTCTGAGAAGCACTTTATTGACAACATCTACATGCCAATGGGATTAGGCCTCTCCTCCTGCAGCCAAACTGTGATCTGTGTCCCCAACTGTACATGGCGCAACTATAGAGCAGAAGTTCATTTATAACCCAAGAACAAACCCCAGAGGTTCAAGAGCACCACTATTGTTTATCCCAAGCACACTAACGTTATTTACACTACTACCCTGGATTACGACTGCAAGAAGTGCATGAGGCGTTTCCTATCCCGCGTAGAGCTGGAATCTGCCGAACACCTGGGCAATGAGTGCTTCGGAGATGAATTTAGTTATATTCTCTCCTTACTGCCCAAGTTTAGAACCCTAATCTTTTGGAATTTACGGGAACACTTGTACCACATAATTTACCGTTTGCCACTTTCCTTGTACAAGTTGGCTTTAAAAAAAACCATTGCTTTTACAGTTGTTTGCCCCCGNNCGGGGTACAAATAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC
Full Trace Sequence: GGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTGGCAGACTGAACCTGCAGGATGTCCCTGATCTGCTGGACATGAAGAAGAAAGGTGAAAGAGTGTTGGACAGCCCTGAACTCTGGGCTCCCCCCCAGCCCCTGCCCCAGTAACTGGCACCTGTCTGCTGTGGCAACTGAGAAATCTCCTGAGCAAGACATCTCTGGGCACAATGCCCCAACAAATTTGGCCCTCTCGTTAAGCCTATCCAGCAGCTTCACACCAAGACTGTGCCCTTTATCGCTCGGAGAGGGTGTGGAGTTTGATCCGCTGCCACCAAAGGAGATAAGGTACACCTCATCAGTTAAATATGATTCTGAGAAGCACTTTATTGACAACATCTACATGCCAATGGGATTAGGCCTCTCCTCCTGCAGCCAAACTGTGATCTGTGTCCCCAACTGTACATGGCGCAACTATAGAGCAGAAGTTCATTTATAACCCAAGAACAAACCCCAGAGGTTCAAGAGCACCACTATTGTTTATCCCAAGCACACTAACGTTATTTACACTACTACCCTGGATTACGACTGCAAGAAGTGCATGAGGCGTTTCCTATCCCGCGTAGAGCTGGAATCTGCCGAACACCTGGGCAATGAGTGCTTCGGAGATGAATTTAGTTATATTCTCTCCTTACTGCCCAAGTTTAGAACCCTAATCTTTTGGAATTTACGGGAACACTTGTACCACATAATTTACCGTTTGCCACTTTCCTTGTACAAGTTGGCTTTAAAAAAAACCATTGCTTTTACAGTTGTTTGCCCCCGNNCGGGGTACAAATAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTGGCAGACTGAACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839891
dbEST ID: 79657593
Trimmed Sequence: ACTGTAATTATTGTGATCAAAGTGTCCCAGTAATTCCAAAATGATTAGGTTCTTAAACTTTGGCAGTAAAGAGAGAATATAACTAAAATCATCTCCGAAGCACTCATTGCCCAGGTGTTCGGCAGATTCCAGCTCTACGCTGGATAGGAAACGCCTCATGCACTTCTTGCAGTTGTAATCCAGGGTAGTAGTGTAAATAACCTTAGTGTGCTTGGGATAAACAATAGTGGTGCTCTTGAACCTCTGGGGTTTGTTCTTGGGTTCTAAATGAACTTCTGCTCTATAGTTGCGCCATGTACAGTTGGGGACACAGATCACAGTTTGGCTGCAGGAGGAGAGGCCTAATCCCATTGGCATGTAGATGTTGTCAATAAAGTGCTTCTCAGAATCATATTTAACTGATGAGGTGTACCTTATCTCCTTTGGTGGCAGCGGATCANACTCCACACCCTCTCCGAGCGATAAAGGGCACAGTCTTGGTGTGAAGCTGCTGGATAGGCTTAACGAGAGGGCCAAATTTGTTGGGGCATGTGCCCAGAGATGTCTTGCTCAGGAAAATTCTCAGTTGCCACACAGACAAGTGCCAATACTGGGGCAAGGGCTGGGGGGGAGCCAAAAATCAAGCCTGTTCCACCCTCCCTCCCCTTTCCTCTTCTGGTCCTCCAAAATCAGGAAACCCCTCCAAGGTCAATCCTCCCACCCATGGGGGCCAACCTTTTTTTTTCCAAATTTTGCCAATAAAAAAAAAAAAAAAAATAAA
Full Trace Sequence: GAAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGTAATTATTGTGATCAAAGTGTCCCAGTAATTCCAAAATGATTAGGTTCTTAAACTTTGGCAGTAAAGAGAGAATATAACTAAAATCATCTCCGAAGCACTCATTGCCCAGGTGTTCGGCAGATTCCAGCTCTACGCTGGATAGGAAACGCCTCATGCACTTCTTGCAGTTGTAATCCAGGGTAGTAGTGTAAATAACCTTAGTGTGCTTGGGATAAACAATAGTGGTGCTCTTGAACCTCTGGGGTTTGTTCTTGGGTTCTAAATGAACTTCTGCTCTATAGTTGCGCCATGTACAGTTGGGGACACAGATCACAGTTTGGCTGCAGGAGGAGAGGCCTAATCCCATTGGCATGTAGATGTTGTCAATAAAGTGCTTCTCAGAATCATATTTAACTGATGAGGTGTACCTTATCTCCTTTGGTGGCAGCGGATCANACTCCACACCCTCTCCGAGCGATAAAGGGCACAGTCTTGGTGTGAAGCTGCTGGATAGGCTTAACGAGAGGGCCAAATTTGTTGGGGCATGTGCCCAGAGATGTCTTGCTCAGGAAAATTCTCAGTTGCCACACAGACAAGTGCCAATACTGGGGCAAGGGCTGGGGGGGAGCCAAAAATCAAGCCTGTTCCACCCTCCCTCCCCTTTCCTCTTCTGGTCCTCCAAAATCAGGAAACCCCTCCAAGGTCAATCCTCCCACCCATGGGGGCCAACCTTTTTTTTTCCAAATTTTGCCAATAAAAAAAAAAAAAAAAATAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGTAATTATTGTGATCAAAG