ORFeome > fam195a ORF1 – XORFeome v1.0

fam195a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fam195a
Gene ID: 999196
Gene Page ID: 999190
ORF Xenbase ID: 17275227

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042271
Original XGC clone length: 441

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ824354
dbEST ID: 79642056
Trimmed Sequence: ATGTACACCATAACCCGAGGGCCCAGCAAGCTAACGACCCAGAGGAGAACAGGCCCCAAGCAGCAGATTGACAGCAAACTGCAGGAAGTGAAGAACAAGCAGCAGATTCTCGTCCCCAATACACCCAACGGTCAGGACTCCCTCCCAAGCAGTGCCCCTCCAAAACTCGTATTTAACCGTGTAAATGGTAAGAGGAGCCAGGCGCCAGGCCCTGAACTAGAAAGAGAAGTGTACACACTGGCACACGAAGAGAACGTCGGATTCATATATCAAGCTTGGCAAGAAGTAAAACATCAGATGGAGGAGCCACAGCAGAACGGATGCACCCCCCAGCAATATCAAGATCAGAGCCCTGACACCCACCTTAAAAACTTCGTTCCTATAGATCTGGACGAGTGGTGGGCAGAGCGCTTCTTAGCCAACATTGAGAACTGCGCTTT
Full Trace Sequence: CAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACACCATAACCCGAGGGCCCAGCAAGCTAACGACCCAGAGGAGAACAGGCCCCAAGCAGCAGATTGACAGCAAACTGCAGGAAGTGAAGAACAAGCAGCAGATTCTCGTCCCCAATACACCCAACGGTCAGGACTCCCTCCCAAGCAGTGCCCCTCCAAAACTCGTATTTAACCGTGTAAATGGTAAGAGGAGCCAGGCGCCAGGCCCTGAACTAGAAAGAGAAGTGTACACACTGGCACACGAAGAGAACGTCGGATTCATATATCAAGCTTGGCAAGAAGTAAAACATCAGATGGAGGAGCCACAGCAGAACGGATGCACCCCCCAGCAATATCAAGATCAGAGCCCTGACACCCACCTTAAAAACTTCGTTCCTATAGATCTGGACGAGTGGTGGGCAGAGCGCTTCTTAGCCAACATTGAGAACTGCGCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGACGGCACATAAAAAAAAATAAAAAAAAAAAAAAAANNGNGNTGCCCCTGCCCCCCCCTGTTTTCCCCCCGGGGTGGGCCCCCCCGGGGTTTTTGTTTCCCGGGGTTTTTTTTTCTGGGCCTCCGGAAAAAAAAAAAGGCAAGGGGGGATTACCCCTTCCGGCCGCCCGGGGCGGTGGCAAATATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACACCATAACCCGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829713
dbEST ID: 79647415
Trimmed Sequence: AGCGCAGTTCTCAATGTTGGCTAAGAAGCGCTCTGCCCACCACTCGTCCAGATCTATAGGAACGAAGTTTTTAAGGTGGGTGTCAGGGCTCTGATCTTGATATTGCTGGGGGGTGCATCCGTTCTGCTGTGGCTCCTCCATCTGATGTTTTACTTCTTGCCAAGCTTGATATATGAATCCGACGTTCTCTTCGTGTGCCAGTGTGTACACTTCTCTTTCTAGTTCAGGGCCTGGCGCCTGGCTCCTCTTACCATTTACACGGTTAAATACGAGTTTTGGAGGGGCACTGCTTGGGAGGGAGTCCTGACCGTTGGGTGTATTGGGGACGAGAATCTGCTGCTTGTTCTTCACTTCCTGCAGTTTGCTGTCAATCTGCTGCTTGGGGCCTGTTCTCCTCTGGGTCGTTAGCTTGCTGGGCCCTCGGGTTATGGTGTACATGG
Full Trace Sequence: GGCCGGGAAACGCTATGAACCATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCGCAGTTCTCAATGTTGGCTAAGAAGCGCTCTGCCCACCACTCGTCCAGATCTATAGGAACGAAGTTTTTAAGGTGGGTGTCAGGGCTCTGATCTTGATATTGCTGGGGGGTGCATCCGTTCTGCTGTGGCTCCTCCATCTGATGTTTTACTTCTTGCCAAGCTTGATATATGAATCCGACGTTCTCTTCGTGTGCCAGTGTGTACACTTCTCTTTCTAGTTCAGGGCCTGGCGCCTGGCTCCTCTTACCATTTACACGGTTAAATACGAGTTTTGGAGGGGCACTGCTTGGGAGGGAGTCCTGACCGTTGGGTGTATTGGGGACGAGAATCTGCTGCTTGTTCTTCACTTCCTGCAGTTTGCTGTCAATCTGCTGCTTGGGGCCTGTTCTCCTCTGGGTCGTTAGCTTGCTGGGCCCTCGGGTTATGGTGTACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAAACATATATTTGAGGCCCGAGCTTAAGACTGGCCGTCGTTTACATCNNNGGGGAAACAGGGGAAATTNCGTAGGGCAATTAAAGAAACGTGAATCTGGTATATTGGGGCTAGCGATTCCCCTTCGTTACCCCGGTTTTAACATGGAACAAACTGAAACCGTTTTCCTTCGGTTCTGGATTGTTATTACCCCGAACGAATTCCCGGGCAAGGTTTCAAACAGAAATATACTCCAAAAAGAAGCTGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCGCAGTTCTCAATGTTGG