ORFeome > fam46a ORF1 – XORFeome v1.0

fam46a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fam46a
Gene ID: 5843515
Gene Page ID: 5843474
ORF Xenbase ID: 17275335

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124951
Original XGC clone length: 1209

Human orthology & disease relationships

NCBI Entrez ID: 55603
Ensembl gene IDs: ENSG00000112773
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 147891

Library Location

Plate ID: GDExl11083
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ837479
dbEST ID: 79655181
Trimmed Sequence: ATGGCAGATGATGAGCACTCAAACCAGAGCGGGATAAGCACGGGAAATTGCGATAGCGCCAACTGCAATGTCCTGAGCTGGGAGCAAGTGCAGCGGCTGGACGCTATCCTCACCGAAACCATTCCCATCCACGGCCGCGGCAACTTCCCGACCCTGGAGATGAAGCCCAGTCAGATCGTGAAGGTGGTGCGGAGCCGCCTGGAGGAGAAGGGGATAAGGGTCAGGGATGTTCGGCTGAACGGCTCGGCGGCCAGTCACATTCTGCACGAGGACAGCGGCTTGGGCTATAAGGACCTGGACCTCATCTTCTGCACCGACCTCACAGGGGAGGCCGAGTTCCACACTGTCAAGGATGTAGTGCTGGACTGCTTGCTGGACTTCTTACCCGAGGGGGTTAACAAAGAGAAGATCTCGCCCCTCACCCTAAAGGAGGCATATGTGCAGAAAATGGTAAAAGTCTGCAACGACTCCGATCGATGGAGTCTAATCTCCTTATCCAACAACCATGGAAAAAATGTGGAACTGAAGTTTATGGATTCTTTGCGGAGGCAATTTGAATTCAGCGTTGATTCCTTTCAGATTAAACTGGATTCTCTTCTACTGTTTTATGAGTGTTCCCAGAACCCAATGACCGAAACTTTTCACCCACCATTATTTGGGGAGAGTGCCAATGGGGGATTTCCAAAAAGCCTTTGATCCTCCTTTGTACCAGGTTATTGCCACCCAAGAATCCCTAAGAAAAATCCGTGGAAGGTTGCCCTTGGTCAGGTTTTTCCAACCCTTTTTGGTAAGGGGGCCTTTCGGGGGGGA
Full Trace Sequence: CGCGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGATGATGAGCACTCAAACCAGAGCGGGATAAGCACGGGAAATTGCGATAGCGCCAACTGCAATGTCCTGAGCTGGGAGCAAGTGCAGCGGCTGGACGCTATCCTCACCGAAACCATTCCCATCCACGGCCGCGGCAACTTCCCGACCCTGGAGATGAAGCCCAGTCAGATCGTGAAGGTGGTGCGGAGCCGCCTGGAGGAGAAGGGGATAAGGGTCAGGGATGTTCGGCTGAACGGCTCGGCGGCCAGTCACATTCTGCACGAGGACAGCGGCTTGGGCTATAAGGACCTGGACCTCATCTTCTGCACCGACCTCACAGGGGAGGCCGAGTTCCACACTGTCAAGGATGTAGTGCTGGACTGCTTGCTGGACTTCTTACCCGAGGGGGTTAACAAAGAGAAGATCTCGCCCCTCACCCTAAAGGAGGCATATGTGCAGAAAATGGTAAAAGTCTGCAACGACTCCGATCGATGGAGTCTAATCTCCTTATCCAACAACCATGGAAAAAATGTGGAACTGAAGTTTATGGATTCTTTGCGGAGGCAATTTGAATTCAGCGTTGATTCCTTTCAGATTAAACTGGATTCTCTTCTACTGTTTTATGAGTGTTCCCAGAACCCAATGACCGAAACTTTTCACCCACCATTATTTGGGGAGAGTGCCAATGGGGGATTTCCAAAAAGCCTTTGATCCTCCTTTGTACCAGGTTATTGCCACCCAAGAATCCCTAAGAAAAATCCGTGGAAGGTTGCCCTTGGTCAGGTTTTTCCAACCCTTTTTGGTAAGGGGGCCTTTCGGGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGATGATGAGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837478
dbEST ID: 79655180
Trimmed Sequence: ATTACAAGGTAACCAAGTGGAGTATGTATGCTGTTGGCATGTGAAAACAGGTTGAACTTGGGCAATATAGTAATTGCTGAAGTTAGCATCTGCTACATATGGGGCTGGTTGATAGTAGCAAGTTACATTAGCCACATTAGGGATAATGTTTTGTTCAGCCAAGACACGGATTGCTAGCATGGTGATAAGACTCAAAGTCTGCCTTCTTTCATGGCCCATCAAGCAAACTGTGCTTTCATTGACTACACCATGAAGAGTCATGAGAGAGTCATACTTGCGGTCTTCTAACCCCACAAAGTGGTTCTGCAAGTAAGACTCCAGCTTTCTTTGCTGCTCACCAATGTCCGAAAAGTCAATGAAAAATCTAGAACACATGTACTTCTGCAGAGACTTCATCTCTGTTTCTGAAGCTGCCCTGAAGCCCCTTACTAAAAGGTTGCAGTACTTGAGAAGGCCACCTCCACGGATCTCCTCACGATTCCTGATGGCGGTAGCCTTGTTACGAGGATGATCAAAGCCTCGTGCAAATCGCCATACACACTCGCCCCCTCAACGGGTGGGGGGGGGGGTGGCAACCATTGGGGTCGGGGGAGCAGGGGAAACCCAATAAAAAAAAAATGAGGATATATCTGATAAAAAACAAAGGCGAAAAACAATTTGGTTCGGCAGGGAACGAAAAAAATACGATTCCAAGGTTTTTCCGAGAGATTTTTTGGGGGGGGGGGAGTTAAAAAAAGAGGGGGGGGGAAAAACCTTGGGGGAAGGGGGT
Full Trace Sequence: GAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTACAAGGTAACCAAGTGGAGTATGTATGCTGTTGGCATGTGAAAACAGGTTGAACTTGGGCAATATAGTAATTGCTGAAGTTAGCATCTGCTACATATGGGGCTGGTTGATAGTAGCAAGTTACATTAGCCACATTAGGGATAATGTTTTGTTCAGCCAAGACACGGATTGCTAGCATGGTGATAAGACTCAAAGTCTGCCTTCTTTCATGGCCCATCAAGCAAACTGTGCTTTCATTGACTACACCATGAAGAGTCATGAGAGAGTCATACTTGCGGTCTTCTAACCCCACAAAGTGGTTCTGCAAGTAAGACTCCAGCTTTCTTTGCTGCTCACCAATGTCCGAAAAGTCAATGAAAAATCTAGAACACATGTACTTCTGCAGAGACTTCATCTCTGTTTCTGAAGCTGCCCTGAAGCCCCTTACTAAAAGGTTGCAGTACTTGAGAAGGCCACCTCCACGGATCTCCTCACGATTCCTGATGGCGGTAGCCTTGTTACGAGGATGATCAAAGCCTCGTGCAAATCGCCATACACACTCGCCCCCTCAACGGGTGGGGGGGGGGGTGGCAACCATTGGGGTCGGGGGAGCAGGGGAAACCCAATAAAAAAAAAATGAGGATATATCTGATAAAAAACAAAGGCGAAAAACAATTTGGTTCGGCAGGGAACGAAAAAAATACGATTCCAAGGTTTTTCCGAGAGATTTTTTGGGGGGGGGGGAGTTAAAAAAAGAGGGGGGGGGAAAAACCTTGGGGGAAGGGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTACAAGGTAACCAAGTGGAG