ORFeome > fam49a ORF1 – XORFeome v1.0

fam49a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fam49a
Gene ID: 866542
Gene Page ID: 854179
ORF Xenbase ID: 17275347

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123177
Original XGC clone length: 972

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ838071
dbEST ID: 79655773
Trimmed Sequence: ATGGGTAATCTTCTTAAGGTGCTTACCAGGGAAATTGAAAACTATCCACATTTTTTCCTGGATTTTGAAAATGCTCAGCCGACTGATGGGGAAAGGGAAGTGTGGAACCAAGTTAATGCAGTTTTGCAGGATTCAGAGAGCATTCTGTCAGATCTTCAAGCCTATAAGGGAGCTGGACAAGAGATAAGAGATGCTATACAAAATCCCAACGATATCCACCTTCAAGAAAAAGCCTGGAATTCTGTGTGTCCTCTGGTTGTGAGGCTGAAGCGCTTCTATGAATTTTCTTTAATACTTGAGAAAGCTTTGCAGAGTTTGTTGGAGTCCCTGACCTTTCCGCCTTACGCTCCTACACAGCATCTAGAGCGAGAGCAAGCCCTTGCCAAAGAGTTTGCAGAAATTTTACATTTCACCTTGCGTTTTGATGAGCTTAAGATGAGAAATCCACCAATTCAAAATGACTTCAGTTACTACAGGAGGACAATAAGTCGTAACAGGATAAACAACATGCATCTATACTTTGAGAACAACGTCAACAATGAAATGGCCAACAGAATGTCCCTGTTTTATGCAGAAGCCACACCAATGCTAAAGACTTTGAGTAATGGGACGACAAGCTTTGTCTCCAATAACAAAACCTTACCCATTGAAAATACACAGAACGGCTTAGTACGATGGCCCATGTATGTAAGGTCATGGCTGAAAGCCCCAAATAACGCAGCCCAAATCCCC
Full Trace Sequence: GGACCCCAAATAATGGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTAATCTTCTTAAGGTGCTTACCAGGGAAATTGAAAACTATCCACATTTTTTCCTGGATTTTGAAAATGCTCAGCCGACTGATGGGGAAAGGGAAGTGTGGAACCAAGTTAATGCAGTTTTGCAGGATTCAGAGAGCATTCTGTCAGATCTTCAAGCCTATAAGGGAGCTGGACAAGAGATAAGAGATGCTATACAAAATCCCAACGATATCCACCTTCAAGAAAAAGCCTGGAATTCTGTGTGTCCTCTGGTTGTGAGGCTGAAGCGCTTCTATGAATTTTCTTTAATACTTGAGAAAGCTTTGCAGAGTTTGTTGGAGTCCCTGACCTTTCCGCCTTACGCTCCTACACAGCATCTAGAGCGAGAGCAAGCCCTTGCCAAAGAGTTTGCAGAAATTTTACATTTCACCTTGCGTTTTGATGAGCTTAAGATGAGAAATCCACCAATTCAAAATGACTTCAGTTACTACAGGAGGACAATAAGTCGTAACAGGATAAACAACATGCATCTATACTTTGAGAACAACGTCAACAATGAAATGGCCAACAGAATGTCCCTGTTTTATGCAGAAGCCACACCAATGCTAAAGACTTTGAGTAATGGGACGACAAGCTTTGTCTCCAATAACAAAACCTTACCCATTGAAAATACACAGAACGGCTTAGTACGATGGCCCATGTATGTAAGGTCATGGCTGAAAGCCCCAAATAACGCAGCCCAAATCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTAATCTTCTTAAGGTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838070
dbEST ID: 79655772
Trimmed Sequence: CTGAAGCATAGCTCGGATCTGTTTTGAAGTGGATTCGTCATTCAGGTGTTTTGCTGTAAACCTGAGAGCATTTAACGGCCCGTCCACGCAATCGGGTGGCTGCTCCTTCAGAAGCTTTATACACCCCTTCATATCACTCTTCGACGTCTTGCGGAAAGCACCCACAGGATGCACGTGATCATACAGGATGATAACTCCGACCATGACTCTCATACAGAACATGAGCGTGTCTTCACTGGTGAATCGGCTGCTGTACTCTGGTGTTTCCAGCATGACCTTACATACACTGGCCATTGTACTTAAGCAGTCTGTTGTATTTTCAATGGGTAACGTTTTGTTATCGGAGACAAAGCTTGTTGTGGCATTACTCAAAGTCTTTAGCATTGGTGTGGCTTCTGCATAAAACAGGGACATTCTGTTGGCCATTTCATTGTTGACGTTGTTCTCAATGTCTAGATGCATGTTGTTTATCCTGTTACGACTTATTGTCCTCCTGTAGTAGCTGAAGTCATTTTGAATTGCTGGATTTCTCATCTTAAGCGCATCAAAACGCAAGGTGAGTGGTGAATTTCTGCAAACTCTTTGGCAAGGGCTTGCTCTCGCTTCAAAAGCCGTGTAGGAGGGTAGGGGGGAAGGGTCGGGGGGATCCGACAGAGCCTGCAAAACCTTTGCAAGGTCTTTAAAAAAAGGTTCTAAAAAAGCGCCTTCGCGCCTCGGAACCGCAAAGGAGCCAAGGAGAGGGGGGGGGGGGGTTTTTTTCTTGGGAAG
Full Trace Sequence: GGAGAAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGAAGCATAGCTCGGATCTGTTTTGAAGTGGATTCGTCATTCAGGTGTTTTGCTGTAAACCTGAGAGCATTTAACGGCCCGTCCACGCAATCGGGTGGCTGCTCCTTCAGAAGCTTTATACACCCCTTCATATCACTCTTCGACGTCTTGCGGAAAGCACCCACAGGATGCACGTGATCATACAGGATGATAACTCCGACCATGACTCTCATACAGAACATGAGCGTGTCTTCACTGGTGAATCGGCTGCTGTACTCTGGTGTTTCCAGCATGACCTTACATACACTGGCCATTGTACTTAAGCAGTCTGTTGTATTTTCAATGGGTAACGTTTTGTTATCGGAGACAAAGCTTGTTGTGGCATTACTCAAAGTCTTTAGCATTGGTGTGGCTTCTGCATAAAACAGGGACATTCTGTTGGCCATTTCATTGTTGACGTTGTTCTCAATGTCTAGATGCATGTTGTTTATCCTGTTACGACTTATTGTCCTCCTGTAGTAGCTGAAGTCATTTTGAATTGCTGGATTTCTCATCTTAAGCGCATCAAAACGCAAGGTGAGTGGTGAATTTCTGCAAACTCTTTGGCAAGGGCTTGCTCTCGCTTCAAAAGCCGTGTAGGAGGGTAGGGGGGAAGGGTCGGGGGGATCCGACAGAGCCTGCAAAACCTTTGCAAGGTCTTTAAAAAAAGGTTCTAAAAAAGCGCCTTCGCGCCTCGGAACCGCAAAGGAGCCAAGGAGAGGGGGGGGGGGGGTTTTTTTCTTGGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGAAGCATAGCTCGGATCTGT