ORFeome > fam50a ORF2 – XORFeome v1.0

fam50a ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fam50a
Gene ID: 970300
Gene Page ID: 970296
ORF Xenbase ID: 17275365

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108795
Original XGC clone length: 1023

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ837671
dbEST ID: 79655373
Trimmed Sequence: ATGGCGCAGTACAAGGGGGCCGCTAGCGAAGCCGGGAGGGCGATGCAACTTATGAAGAAGCGGGAGAAGCAGCGAGAGCAGCTGGAACAGATGAAGCTGAAAATAGCGGAGGAGAATGTGGTTAAGGCAAATATAAATAAGAAATTCTCGGCACATTATGATGCGGTGGAGGCGGAGCTAAAATCAAGCACTGTGGGATTGGTTACCCTTAATGACATGAAAGCAAAACAAGAGGCTCTGGTGAAAGAGCGAGAGAAGCAGCTGGCAAAGAAGGAGCAATTCAAGGACCTCCAGTTAATGCTGGAGAAGCAGAGGGAAAGGGAGCGAAAGAAAGAGCAAAAGCGCAAAATAGCCAGCTTATCTTTCAACTTAGAGGAGGATGAGGAATGTGAAGATGAGGAGGGTGAANAAGAAGAATCAGACAAAGAGGACCCACCTGAGGAGAAGAAGAAGAAGAAGAAGAAGAAGCTTGGCAAAAAATCCTGATGTGGATACAAGTTTCCTGCCAGACAAAAACCGCGAGGAAGAGGAGAACCGACTTCGAGAAGAACTAAGACAGGAGTGGGGAGCACAAGCAAGAGAAGATAAAAAATGAAAATATTTTAATCACCGTTTAGCTACTGGGAGGGCTCGCGGCCCCCGACGGACAGTAAATAATAAAAAAAGGAAACAACTTCCAAAAATTCCTGCCGGAGAACCACTGAAGAAGCCGACAAGAAAATACTTTTTTTTT
Full Trace Sequence: CGAGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCAGTACAAGGGGGCCGCTAGCGAAGCCGGGAGGGCGATGCAACTTATGAAGAAGCGGGAGAAGCAGCGAGAGCAGCTGGAACAGATGAAGCTGAAAATAGCGGAGGAGAATGTGGTTAAGGCAAATATAAATAAGAAATTCTCGGCACATTATGATGCGGTGGAGGCGGAGCTAAAATCAAGCACTGTGGGATTGGTTACCCTTAATGACATGAAAGCAAAACAAGAGGCTCTGGTGAAAGAGCGAGAGAAGCAGCTGGCAAAGAAGGAGCAATTCAAGGACCTCCAGTTAATGCTGGAGAAGCAGAGGGAAAGGGAGCGAAAGAAAGAGCAAAAGCGCAAAATAGCCAGCTTATCTTTCAACTTAGAGGAGGATGAGGAATGTGAAGATGAGGAGGGTGAANAAGAAGAATCAGACAAAGAGGACCCACCTGAGGAGAAGAAGAAGAAGAAGAAGAAGAAGCTTGGCAAAAAATCCTGATGTGGATACAAGTTTCCTGCCAGACAAAAACCGCGAGGAAGAGGAGAACCGACTTCGAGAAGAACTAAGACAGGAGTGGGGAGCACAAGCAAGAGAAGATAAAAAATGAAAATATTTTAATCACCGTTTAGCTACTGGGAGGGCTCGCGGCCCCCGACGGACAGTAAATAATAAAAAAAGGAAACAACTTCCAAAAATTCCTGCCGGAGAACCACTGAAGAAGCCGACAAGAAAATACTTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCAGTACAAGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837670
dbEST ID: 79655372
Trimmed Sequence: CCGGATCGTATATTTATCCCATTTCTTTTCTGGGTCATAAGGTTCCCACCGGCTTGCTGGGAATATGTGCTTGTTCTTCTCATACCAGCTACGCAGGACAACTTTGCCAGCATGGGACTCATCCTTTTCTACAGTGGCATCACTCAGCAGTCGCACATCCTCGTGAACATCAAAGTTAAAAAGGGGACCACTTTTGCCTCTCGCCTTTGTCACAATGAAGTCATAAAAACTGTGATGATGTGGAATGATAAGATCTTCCTTAATGTACATGAGCTGTTCCACGCCTGCAGATCGCAGCTCACTAAAGTCTTTCCGTAGGCTCTCCAGTGCTTTCTGCAGGAATTGTTGGATACTGTTTCCTTTCTTCATCTTTACTGTCCGTCGGTGCCCGGAGCCATCCCAGTAGCTAAAGGTGATTTCAATTTCTTCACTTTTTATCTTCTCCTGCTTGTGCTCCCACTCCTGTCTTAGTTCTTCTCGAAGTCGGTTCTCCTCTTCCTCGCGGTCTCTGTCTGGCAGGAAACTTGTATCCACATCAGGATTTTTGCCAAGCTTCTTCTTCTTCTTCTTCTTCTTCTCCTCAGGTGGGTCCTCTTTGTCTGATTCATCTTCTTCACCCTCCTCATCTTCACATTCCTCATCCTCCTTCTAGTTGGAAAATAAGCTGGCTATGTTTCGCTTTTGCTTTTTCTTCGCTTCCTTTTCCTCTTCTTCTCCCACAATAACAGGAAGGTGTTGGAGTTCCCCTTTCATTCCCGCTGGCTTCGGGTGGTGTGTTACCAAAGCCTCTTGTTGTTCGTTTCGGGTCGGTGGGCGTAACCGGTGCCCCGGTGGCTGGATTGATGCTCCCCCTCCGCCCCCACCACATGGGGCCAAAAATTTTCTAATTATATTTTCCCCAACCCCCGTCCCCCCCCCCCATTTTCAAGTAAACCTGAGCCGCGGGCGCACGCCGGCTTCGCCCCGCGTCCCGCAAAGTGGGAACCCCGGCCCGGGCGTCCGGGAGGCGGCCCCCTGTGAGGGGGGGCGGGGGGGGGCGGCCTTGTGGTGGTCGAGGTGTGGGGGGTTATTGAAAAAAAAAAATAAAACACAAAATATATTAAAAAGAGAAAAAAAAAAAAAACGAAACCCAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATAAATGATGGGGGCCCGCCCCACACAACAT
Full Trace Sequence: TGGCAGGTAACAGCCACTGAACATGTACAAACGAACCACTAGACGGGGAAAACAGCCAGGAAGGCAATAATGATTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCGGATCGTATATTTATCCCATTTCTTTTCTGGGTCATAAGGTTCCCACCGGCTTGCTGGGAATATGTGCTTGTTCTTCTCATACCAGCTACGCAGGACAACTTTGCCAGCATGGGACTCATCCTTTTCTACAGTGGCATCACTCAGCAGTCGCACATCCTCGTGAACATCAAAGTTAAAAAGGGGACCACTTTTGCCTCTCGCCTTTGTCACAATGAAGTCATAAAAACTGTGATGATGTGGAATGATAAGATCTTCCTTAATGTACATGAGCTGTTCCACGCCTGCAGATCGCAGCTCACTAAAGTCTTTCCGTAGGCTCTCCAGTGCTTTCTGCAGGAATTGTTGGATACTGTTTCCTTTCTTCATCTTTACTGTCCGTCGGTGCCCGGAGCCATCCCAGTAGCTAAAGGTGATTTCAATTTCTTCACTTTTTATCTTCTCCTGCTTGTGCTCCCACTCCTGTCTTAGTTCTTCTCGAAGTCGGTTCTCCTCTTCCTCGCGGTCTCTGTCTGGCAGGAAACTTGTATCCACATCAGGATTTTTGCCAAGCTTCTTCTTCTTCTTCTTCTTCTTCTCCTCAGGTGGGTCCTCTTTGTCTGATTCATCTTCTTCACCCTCCTCATCTTCACATTCCTCATCCTCCTTCTAGTTGGAAAATAAGCTGGCTATGTTTCGCTTTTGCTTTTTCTTCGCTTCCTTTTCCTCTTCTTCTCCCACAATAACAGGAAGGTGTTGGAGTTCCCCTTTCATTCCCGCTGGCTTCGGGTGGTGTGTTACCAAAGCCTCTTGTTGTTCGTTTCGGGTCGGTGGGCGTAACCGGTGCCCCGGTGGCTGGATTGATGCTCCCCCTCCGCCCCCACCACATGGGGCCAAAAATTTTCTAATTATATTTTCCCCAACCCCCGTCCCCCCCCCCCATTTTCAAGTAAACCTGAGCCGCGGGCGCACGCCGGCTTCGCCCCGCGTCCCGCAAAGTGGGAACCCCGGCCCGGGCGTCCGGGAGGCGGCCCCCTGTGAGGGGGGGCGGGGGGGGGCGGCCTTGTGGTGGTCGAGGTGTGGGGGGTTATTGAAAAAAAAAAATAAAACACAAAATATATTAAAAAGAGAAAAAAAAAAAAAACGAAACCCAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATAAATGATGGGGGCCCGCCCCACACAACAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGGATCGTATATTTATCCCA