ORFeome > fam89a ORF1 – XORFeome v1.0

fam89a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fam89a
Gene ID: 5796287
Gene Page ID: 5796232
ORF Xenbase ID: 17275431

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124949
Original XGC clone length: 501

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ837443
dbEST ID: 79655145
Trimmed Sequence: ATGAGTGGATCACACACTGCTATAGCCCCGTTAGCACCTTGTATGGAGGGTCTTCCACCACTGCCAAAAAGCCTCAGTGGACTTCTTAATTCTAGTGGAGGATCTGGCTGGAGGGACCTGGAAAGAGTCTACGCTCAGAAGTCTCGTATCCAGGATGACTTAAGCCGTGGTGGCACAAGTGGTAGTGTCCAAGCTCATCCTAAACCTCCAAATCTGGATGCAGCTCTGGCTCTCCTCAGGAAAGAGATGGTTGGACTTCGGCAGCTGGATATGTCTCTCCTGTGTCAGTTGTATTCCCTGTATGAGTCCATTCAGGAATATAAAGGTGCTTGCCAGGCTGCATCCAGTGCTGACTGTACCTATGCAATGGAGAATGGGTTTTTTGATGAGGAAGAGGAGTATTACCAAGAAGCTGGATCCCTTCATAAGATCGGGAGGGAAAACTCCGAAGGAACCGTATCGCCCATATCCAACGAGGACTGGATACTAGAAAATATTTT
Full Trace Sequence: CTCGGGGGCCCAATAANTGATTTTATTTNTGACTGATAGTGNACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGGATCACACACTGCTATAGCCCCGTTAGCACCTTGTATGGAGGGTCTTCCACCACTGCCAAAAAGCCTCAGTGGACTTCTTAATTCTAGTGGAGGATCTGGCTGGAGGGACCTGGAAAGAGTCTACGCTCAGAAGTCTCGTATCCAGGATGACTTAAGCCGTGGTGGCACAAGTGGTAGTGTCCAAGCTCATCCTAAACCTCCAAATCTGGATGCAGCTCTGGCTCTCCTCAGGAAAGAGATGGTTGGACTTCGGCAGCTGGATATGTCTCTCCTGTGTCAGTTGTATTCCCTGTATGAGTCCATTCAGGAATATAAAGGTGCTTGCCAGGCTGCATCCAGTGCTGACTGTACCTATGCAATGGAGAATGGGTTTTTTGATGAGGAAGAGGAGTATTACCAAGAAGCTGGATCCCTTCATAAGATCGGGAGGGAAAACTCCGAAGGAACCGTATCGCCCATATCCAACGAGGACTGGATACTAGAAAATATTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGGTCAAAAAAAAAAACAAGAAAACTCTGGCCTTGTCGCACTCCTTCCGACACGTTTAAAAAAAAAAAGCCGCCTCTCTCCACAAGGGGGTCCTTGTTGGTTTGTGTTTGGGGGGGAAGAATACCCGGAAAAAAGAAGAACAAAACGCGGGTGGTTGTTTTTGTTTTGTAGGGCGGTGGTGGGGGGGGTGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGGATCACACACTGCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ837442
dbEST ID: 79655144
Trimmed Sequence: AATATTTTCTAGTATCCAGTCCTCGTTGGATATGGGCGATACGGTTCCTTCGGAGTTTTCCCTCCCGATCTTATGAAGGGATCCAGCTTCTTGGTAATACTCCTCTTCCTCATCAAAAAACCCATTCTCCATTGCATAGGTACAGTCAGCACTGGATGCAGCCTGGCAAGCACCTTTATATTCCTGAATGGACTCATACAGGGAATACAACTGACACAGGAGAGACATATCCNGCTGCCGAAGTCCAACCATCTCTTTCCTGAGGAGAGCCAGAGCTGCATCCAGATTTGGAGGTTTAGGATGAGCTTGGACACTACCACTTGTGCCACCACGGCTTAAGTCATCCTGGATACGAGACTTCTGAGCGTAGACTCTTTCCAGGTCCCTCCAGCCAGATCCTCCACTAGAATTAAGAAGTCCACTGAGGCTTTTTGGCAGTGGTGGAAGACCCTCCATACAGGTGCTAACGGGGCTATAGCAGTGTGTGATCCACTCATGG
Full Trace Sequence: GAAGCTGCTTATGAACCATGTAATACGACTCACTACTAGGGGAGACCAGCCTGGAGGGCAAAAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATATTTTCTAGTATCCAGTCCTCGTTGGATATGGGCGATACGGTTCCTTCGGAGTTTTCCCTCCCGATCTTATGAAGGGATCCAGCTTCTTGGTAATACTCCTCTTCCTCATCAAAAAACCCATTCTCCATTGCATAGGTACAGTCAGCACTGGATGCAGCCTGGCAAGCACCTTTATATTCCTGAATGGACTCATACAGGGAATACAACTGACACAGGAGAGACATATCCNGCTGCCGAAGTCCAACCATCTCTTTCCTGAGGAGAGCCAGAGCTGCATCCAGATTTGGAGGTTTAGGATGAGCTTGGACACTACCACTTGTGCCACCACGGCTTAAGTCATCCTGGATACGAGACTTCTGAGCGTAGACTCTTTCCAGGTCCCTCCAGCCAGATCCTCCACTAGAATTAAGAAGTCCACTGAGGCTTTTTGGCAGTGGTGGAAGACCCTCCATACAGGTGCTAACGGGGCTATAGCAGTGTGTGATCCACTCATGGTGCGGACTTTTTTGTACAAAGTTGGCATTATATAAAAGCATTGCTCGTCGCTTTGTTGCACGAACAGGTCACTGTGGTTCCNATTTNNAAAAAAAAAAAAAAAACCAGAAGAAAATAATTTACCATTGGGTGGCGCATCCCCGCCCCCGCGGAAAAAGAAGGGCCCTTCGGGAATCGGGGGGTTTCGGGGTGGGGGTTTTTTGGGGGGGAGAAAGAAAGGGGGAGAAAAGAGAGGAAAAAAGCGGGGGGGGGGTGTGTTTTGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATATTTTCTAGTATCCAGTCCTC