ORFeome > fbp1 ORF1 – XORFeome v1.0

fbp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fbp1
Gene ID: 1002601
Gene Page ID: 1002595
ORF Xenbase ID: 17275527

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053784
Original XGC clone length: 1017

Human orthology & disease relationships

NCBI Entrez ID: 2203
Ensembl gene IDs: ENSG00000165140
Directly associated (OMIM) disease MIM numbers: 229700
Indirectly associated (Lage, et al.) disease MIM numbers: 125851,212065,223000,235700,248500,601382,602485,602579,606003

Library Location

Plate ID: GDExl11002
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ839385
dbEST ID: 79657087
Trimmed Sequence: ATGACGGACCAGGCCCCCTTCAACACTGATGTCATTACCCTGACTCGCTTCGTCATGGAAGAGGGCAGGAAAGCCAAGGGGACCGGGGAGATGACCCAACTGCTGAACTCTATGTGCACGGCTGTGAAAGCCATCTCTTCTGCAGTGCGCAAGGCTGGACTGGCCAACCTCTATGGCATTGCTGGCTCCACTAATGTGACAGGGGACCAAGTGAAAAAACTAGATGTCCTCTCCAATGACCTTGTCATCAACATGCTCAAGTCCTCCTACGGTTCCTGTGTCCTGGTGTCAGAAGAAGACCCGCATGCTCTGATTGTGGAGCCTGATAAACGGGGTAAATACGTGGTGTGCTTTGATCCTTTGGATGGCTCCTCGAACATTGACTGCCTGGCTTCTATTGGTACAATATTCGCCATCTACAAAAAGACTTCTGATGGAGAGCCAACCGAAAAAGATGCTTTACAACCAGGCCGAAACATTGTTGCAGCAGGCTATGCTCTATATGGCAGTGCAACAATGTTGGTTCTTGCCGCAGAATGTGGTGTCAACTGTTTCATGTTGGACCCAGCAATCGGAGAGTTCATTTTAGTGAACCAGGATGTGAAGATCAAAAAGAAGGGTAACATATACAGCCTGAATGAGGGTTATGCCAAGTATTTTTAATGAGCAGTTTCCGAAAACTTACAGAAGAAGAATTTTCGAAAAAAGAAAGCCCACCTTATGGGTGCAGGGTAGTTGGGTTCGAATGGTACCTGATGGGCATCCTTACATTTGGTTTTTATGGGGGGAAAATCCTTTTCGTTTACCCCA
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACGGACCAGGCCCCCTTCAACACTGATGTCATTACCCTGACTCGCTTCGTCATGGAAGAGGGCAGGAAAGCCAAGGGGACCGGGGAGATGACCCAACTGCTGAACTCTATGTGCACGGCTGTGAAAGCCATCTCTTCTGCAGTGCGCAAGGCTGGACTGGCCAACCTCTATGGCATTGCTGGCTCCACTAATGTGACAGGGGACCAAGTGAAAAAACTAGATGTCCTCTCCAATGACCTTGTCATCAACATGCTCAAGTCCTCCTACGGTTCCTGTGTCCTGGTGTCAGAAGAAGACCCGCATGCTCTGATTGTGGAGCCTGATAAACGGGGTAAATACGTGGTGTGCTTTGATCCTTTGGATGGCTCCTCGAACATTGACTGCCTGGCTTCTATTGGTACAATATTCGCCATCTACAAAAAGACTTCTGATGGAGAGCCAACCGAAAAAGATGCTTTACAACCAGGCCGAAACATTGTTGCAGCAGGCTATGCTCTATATGGCAGTGCAACAATGTTGGTTCTTGCCGCAGAATGTGGTGTCAACTGTTTCATGTTGGACCCAGCAATCGGAGAGTTCATTTTAGTGAACCAGGATGTGAAGATCAAAAAGAAGGGTAACATATACAGCCTGAATGAGGGTTATGCCAAGTATTTTTAATGAGCAGTTTCCGAAAACTTACAGAAGAAGAATTTTCGAAAAAAGAAAGCCCACCTTATGGGTGCAGGGTAGTTGGGTTCGAATGGTACCTGATGGGCATCCTTACATTTGGTTTTTATGGGGGGAAAATCCTTTTCGTTTACCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGGACCAGGCCCCCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839384
dbEST ID: 79657086
Trimmed Sequence: TTTCTTTGCATATTTCTTGTAAATGTTCATATATTCCTGTACATCATCTGGAGACCCCAAAGCTATTGGCATCCTCTGGTGGATACTCTCGGGTACTATATCAAGCACTGACTCAAGTCCATTAGTAGCCATTCCTCCAGCCTGCTCCATAATGTAAGCCATTGGGTTGCACTCATACAGAAGTCTCAGCTTGCCCTTTGGGCTCTTTACATTGGCTGGGTACAGAAAGATTCCTCCATACACCAATGTACGATGCACATCAGCTACCATCGAACCAACATACCTTGCACCATAAGGTGAGCTTCCATCTTCTGGAAATTTCTTCTTCTGTAAGTATTCGGTAACTGCTTCATCAAAATACTTGGCATAACCCTCATTCAGGCTGTATATGTTACCCTTCTTTTTGATCTTCACATCCTGGTTCACTAAAATGAACTCTCCGATTGCTGGGTCCAACATGAAACAGTTGACACCACATTCTGCGGCAAGAACCAACATTGTTGCACTGCCATATAGAGCATAGCCTGCTGCAACAATGTTTCGGCCTGGTTGTAAAGCATCTTTTTCGGTTGGCTCTCCATCAGAAGTCTTTTTGTAAATGGCGAATATTGTACCAATAGAACCCAGGCAGTCCATGTTCGAAGAGCCATCCCCAAGGATCAAAACAACACCACTTAATTAACCCCTTTTATCAGGGCTCCACAACCAAAAACAATGCGGGGTCCTCTTCCTGAACCCCAGGAAAACAAGGGAACCCGTAAGGAAG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTTGCATATTTCTTGTAAATGTTCATATATTCCTGTACATCATCTGGAGACCCCAAAGCTATTGGCATCCTCTGGTGGATACTCTCGGGTACTATATCAAGCACTGACTCAAGTCCATTAGTAGCCATTCCTCCAGCCTGCTCCATAATGTAAGCCATTGGGTTGCACTCATACAGAAGTCTCAGCTTGCCCTTTGGGCTCTTTACATTGGCTGGGTACAGAAAGATTCCTCCATACACCAATGTACGATGCACATCAGCTACCATCGAACCAACATACCTTGCACCATAAGGTGAGCTTCCATCTTCTGGAAATTTCTTCTTCTGTAAGTATTCGGTAACTGCTTCATCAAAATACTTGGCATAACCCTCATTCAGGCTGTATATGTTACCCTTCTTTTTGATCTTCACATCCTGGTTCACTAAAATGAACTCTCCGATTGCTGGGTCCAACATGAAACAGTTGACACCACATTCTGCGGCAAGAACCAACATTGTTGCACTGCCATATAGAGCATAGCCTGCTGCAACAATGTTTCGGCCTGGTTGTAAAGCATCTTTTTCGGTTGGCTCTCCATCAGAAGTCTTTTTGTAAATGGCGAATATTGTACCAATAGAACCCAGGCAGTCCATGTTCGAAGAGCCATCCCCAAGGATCAAAACAACACCACTTAATTAACCCCTTTTATCAGGGCTCCACAACCAAAAACAATGCGGGGTCCTCTTCCTGAACCCCAGGAAAACAAGGGAACCCGTAAGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTTGCATATTTCTTGTAAAT