ORFeome > fbxl15 ORF1 – XORFeome v1.0

fbxl15 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fbxl15
Gene ID: 973064
Gene Page ID: 973057
ORF Xenbase ID: 17275545

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053821
Original XGC clone length: 879

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ839465
dbEST ID: 79657167
Trimmed Sequence: ATGGCTAAGGATGAGGACAACAGCAGGGTCCATTTGTTGGATCTCCCTTGGGAAGATGTGTTGGTCCCACATATACTTAGCTATCTCCCACTGAGGCACATACTAAGTCTCCAGAGAGTCAGCAAGCCTTTTCACTCCCTGGTCCACATTTATCTCTGCAATTGCCGACACTTTGACTCTACTCAGTTGGGACCACAGTTACCCAAAACCACCTTCTCTGAGCTTCTTAAGAACAATACTGTATTGCAGAAACTTGACCTACAAAGCTGTTCGGATTGGTTAACAGACAAGGAGCTGCTTCCTATTATTGGCCAAAACCATCACCTCACCTACATCAATTTGAATAGCTGTGGGCAGCTAACCCGCCAGTCATTGGTTGCGATATCGCTCAGCTGTCCTCACCTGCAGAACATTTGTCTTGGTCATTGTGACTGGGTGGACTGTCTTTCAATGCGCAGTTTAGCTGACCATTGCAAATGTTTGGAGGCAATTGACCTGACAGCTTGTCGTCAGTTGAAAGATGACGCCATAAGCTACTTGGTGCAGAAGAGCACAAGACTAANATCCCTGTCACTGGCAGTCAATGCAAACATTAGTGATATTGCTGTTGAAGAAACGGCTAANAGCTGCCGAGATCTGGAGCACCTTGATTTTACAGGATGCTTGCGTNGTAAGAATGATTCTATTAGGACCCTGGCTGATACTGCAACAACCTGAAGTCCCTGAAAGTAAGCACTGCCACAATGTCCCGGATCAAGCTTAAGGAACTTACCGAAAAAAAAAATAATGCTTTAAGTAAAACCCCCTCTTTCCAAAAGGCCTTG
Full Trace Sequence: CGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAAGGATGAGGACAACAGCAGGGTCCATTTGTTGGATCTCCCTTGGGAAGATGTGTTGGTCCCACATATACTTAGCTATCTCCCACTGAGGCACATACTAAGTCTCCAGAGAGTCAGCAAGCCTTTTCACTCCCTGGTCCACATTTATCTCTGCAATTGCCGACACTTTGACTCTACTCAGTTGGGACCACAGTTACCCAAAACCACCTTCTCTGAGCTTCTTAAGAACAATACTGTATTGCAGAAACTTGACCTACAAAGCTGTTCGGATTGGTTAACAGACAAGGAGCTGCTTCCTATTATTGGCCAAAACCATCACCTCACCTACATCAATTTGAATAGCTGTGGGCAGCTAACCCGCCAGTCATTGGTTGCGATATCGCTCAGCTGTCCTCACCTGCAGAACATTTGTCTTGGTCATTGTGACTGGGTGGACTGTCTTTCAATGCGCAGTTTAGCTGACCATTGCAAATGTTTGGAGGCAATTGACCTGACAGCTTGTCGTCAGTTGAAAGATGACGCCATAAGCTACTTGGTGCAGAAGAGCACAAGACTAANATCCCTGTCACTGGCAGTCAATGCAAACATTAGTGATATTGCTGTTGAAGAAACGGCTAANAGCTGCCGAGATCTGGAGCACCTTGATTTTACAGGATGCTTGCGTNGTAAGAATGATTCTATTAGGACCCTGGCTGATACTGCAACAACCTGAAGTCCCTGAAAGTAAGCACTGCCACAATGTCCCGGATCAAGCTTAAGGAACTTACCGAAAAAAAAAATAATGCTTTAAGTAAAACCCCCTCTTTCCAAAAGGCCTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAAGGATGAGGACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839464
dbEST ID: 79657166
Trimmed Sequence: GATCTGGAGGTTTATAAATGGTGCAAAGCCCACAACATCCTGCAGGAGAACCAACGCCCTCTGCAGAGGGGGTTCTACATCAAGCACTACTTCTCTTTTCCGTAAGTTTCCTAAGCTTGATTCCGTGACATTGTGGCAGTGCTTTACTTTCAGGGACTTCAGGTTGTTGCAGTATTCAGCCAGGGTCCTAATAGAATCATTCTTTACACGCAAGCATCCTGTTAAATCAAGGTGCTCCAGATCTCGGCAGCTTTTAGCCGTTTCTTCAACAGCAATATCACTAATGTTTGCATTGACTGCCAGTGACAGGGATTTTAGTCTTGTGCTCTTCTGCACCAAGTAGCTTATGGCGTCATCTTTCAACTGACGACAAGCTGTCAGGTCAATTGCCTCCAAACATTTGCAATGGTCAGCTAAACTGCGCATTGAAAGACAGTCCACCCAGTCACAATGACCAAGACAAATGTTCTGCAGGTGAGGACAGCTGAGCGATATCGCAACCAATGACTGGCGGGTTAGCTGCCCACAGCTATTCAAATTGATGTAGGTGAGGTTGAGGGTTTTGGCCAATAATAAGAAACAGCTCCTTGTCTGTTAACCAATCCGAACAGCTTTTTAGGTCAAGTTTCTGCAATACAATATTGGTTCTTAGAAAGCTAAAAAAAGGTGGTTTTTGGTTAACTGTGGTTCCCAACCGAATTAAAACCAAAGGTGTCCGCCATTTTCCAAAAAAAAATGTTGGGACACAGGAAAGTAGAAAAGGCCTTTGGTTAACC
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATCTGGAGGTTTATAAATGGTGCAAAGCCCACAACATCCTGCAGGAGAACCAACGCCCTCTGCAGAGGGGGTTCTACATCAAGCACTACTTCTCTTTTCCGTAAGTTTCCTAAGCTTGATTCCGTGACATTGTGGCAGTGCTTTACTTTCAGGGACTTCAGGTTGTTGCAGTATTCAGCCAGGGTCCTAATAGAATCATTCTTTACACGCAAGCATCCTGTTAAATCAAGGTGCTCCAGATCTCGGCAGCTTTTAGCCGTTTCTTCAACAGCAATATCACTAATGTTTGCATTGACTGCCAGTGACAGGGATTTTAGTCTTGTGCTCTTCTGCACCAAGTAGCTTATGGCGTCATCTTTCAACTGACGACAAGCTGTCAGGTCAATTGCCTCCAAACATTTGCAATGGTCAGCTAAACTGCGCATTGAAAGACAGTCCACCCAGTCACAATGACCAAGACAAATGTTCTGCAGGTGAGGACAGCTGAGCGATATCGCAACCAATGACTGGCGGGTTAGCTGCCCACAGCTATTCAAATTGATGTAGGTGAGGTTGAGGGTTTTGGCCAATAATAAGAAACAGCTCCTTGTCTGTTAACCAATCCGAACAGCTTTTTAGGTCAAGTTTCTGCAATACAATATTGGTTCTTAGAAAGCTAAAAAAAGGTGGTTTTTGGTTAACTGTGGTTCCCAACCGAATTAAAACCAAAGGTGTCCGCCATTTTCCAAAAAAAAATGTTGGGACACAGGAAAGTAGAAAAGGCCTTTGGTTAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATCTGGAGGTTTATAAATGGTG