ORFeome > fbxo31 ORF1 – XORFeome v1.0

fbxo31 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fbxo31
Gene ID: 6255522
Gene Page ID: 953634
ORF Xenbase ID: 17275599

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130117
Original XGC clone length: 1572

Human orthology & disease relationships

NCBI Entrez ID: 79791
Ensembl gene IDs: ENSG00000103264
Directly associated (OMIM) disease MIM numbers: 615979
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGGGGGTTTTGCCGCTGAAATACTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGTGCGACAAGTTGTGCGTATTCTGACTTACAGGGGGCTGCAGGAGGAGACTACATCGGACTGTAACCGGAAACTATCCTGATCTGGAGGATGAAGATGATTAAGAGATGTGCTGATTGGGGCTGAACTATTAGTCTAAGGACTGGCATCCGTGACACCCTTGAAACTTCGCTCTCTCCTGCAGCTGCCACCTGATATACTCGTGGAGATTTTCTCCTCTCTGCCCGGTACCGAGCGGCCCCATCGGGCCCTTGTGTGCCGGAGGTTCCTACCAGATCCTCAGTACGGACACTATCTGTAAGCGGCGCTGCAAACAATACTATGTTGTCTGTGAGCATCTAGTAAAACTGTAGGTCTCATGAGTTTCCTGCCACTGATGTCTATGTCTTACTGTTGCACCTATACCGACACATCTTGGGCTCCTGGTTTTCAGACATTGTTCCTTCTGGACGACTTCTAATTGTTGTGTTTTACGGTTTATTTACCATTGGATGGATGGATCTTCCCGCACACGGTCCTCTTGTTGATGAAGGTATGAGGTTTAATGCGGTTTTTATATTTCTCTTCACGGAGATGAAATTGCGCCCTTCTTACTGTATTTATGGACACCGACGGTCCCCCCAATGCGGAGAATCCGAATTGGTCCAAATTTCGACCTCCACTACTATCTGCCTTCAAAAATTTTTTATTCACAAATTTTCTGGGAGAAAAAAAAGAAAGAGTTCAGGGCAAGAGCTCCGGGGAAAAACCCCGGGGGGAAACTCCTTTTTAAAAATTCTTTTTTCCGAATACCCAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGTGCGCCAGGT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGATGTCCAAGATGACATATGTAGCGATCATTTCATCATAGGTCTTCGAACGATGGAACATCAGAATGCACGAATCTGCCCCTCATCCCACTGCACTAGCAAACAGATATCAACTCCAACCAAATGAACCCTAAACGATCCTCATCAAATACAGATGCACAAACCTCGGGGTCCGCTATAGACTACTGAATCCAGTGTCCCACGATCGAGGACAATACCATACCAGCACGTCTTAGATCTACCGGGGTATTCCTCATTCCTAGCCATCACCCCATCAGGGAGCACTCAGGACTGCACATTTGGGGGTTTTCGCTCCCTGTCATCGGCATTGCCAACGCCGTTTACATCTTCTTTTGCGAGACTATGCACAGGTGCAGGTTGTTGAGAATGTTCTGATCTATCAGGACCTGCCCCTTTTCAATCATCTTCTTCGTTGCCTGTCAGTCTCTGCTCTCTTTGGATCCGTGACTGGACGTCCACAATAACGCGAAATATCTCATCAATATTCCTTACGTGCTCCACATCGTGAAGCTGCTCTGCACGGGTCATATCAACCTCTATTGTCTGCTGACCTGCTGGAAATTAGGGATCTCCAGTTATTCTGGTAGCCATGGCAATTGTATCCACGGAAGCTGAGCTTGACAATTTACCCGTCCTGGACTCCCTATACGTTCATTAAAAGAAAACCGGGAATTTACCCCGGTCATCCGGAACCCGTTGGGGAAGGTTGGAACAAATTCCCTCTCCCAAAGGTAAATAGCCCGATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTTGTCCAGGATTGCAT