ORFeome > fbxo9 ORF1 – XORFeome v1.0

fbxo9 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fbxo9
Gene ID: 1002454
Gene Page ID: 1002446
ORF Xenbase ID: 17275659

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054961
Original XGC clone length: 1296

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ839299
dbEST ID: 79657001
Trimmed Sequence: ATGGCGGAAGGTGATGAGGATTCTTATACTGACAGCCTGATGTCTAATGAAAATGGGAGACCTGGAGAAACAAATCTTCAGGAAGAGCTACAGATGTTCAGAGCTCGTTGGATGTCTGAACTCACACCAGGATTGAGCTCTGGAGGGCTTGAAAATCGACCTATTAATGCAGCAGCTAGAGGGTCAGTGGGAAAAGTATCAGAAACCAGAGCAAAGCAAGAATTAGCTAAAGAGGAGAAGGCGAAAGAACTTTTTCTTAAGGCAGCAGAGGAGGAACAAAATGGAGCTCTTTACGAAGCTATCAAGTTTTACCGTCAAGCAATGCAGCTTGTGCCAGACATTGAATTCAAAATTAACTACACCTGGTCTCCTGATGGTGACGGGAAAAATTTCATGGATGATGCTAATAATGACAGCAAAATGGCTGACCTTTTATCTTACTTCCAGCAGCAACTAACATTCCAACAGTCTAAACTTTGTCAGTCAGACATTGATGTCACTCAAACTCATATTTCAGTGCTCCCAATGGAGGTGCTGATGTATATTTTTCGCTGGGTGGTATCCAGTGACCTTGATCTCCGAGCACTGGAGCAACTTTCCTTGGTCTGCAAGGGCTTTTATATTTGTGCAAGAGACCCAGAGATCTGGCGCCTGGCATGCCTGAAAGTATGGGGCCGAAACTGTGTAAAAATTCTCCCCTATACCACCCGGGAAGCAGATGTTTCCTGGAAAAACCACGAATTCCAATTTGATGGGGGTATATATCAGGTAAAAACCACATTTTTTACTTTCAAGGGAAAAAACAATC
Full Trace Sequence: CGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAAGGTGATGAGGATTCTTATACTGACAGCCTGATGTCTAATGAAAATGGGAGACCTGGAGAAACAAATCTTCAGGAAGAGCTACAGATGTTCAGAGCTCGTTGGATGTCTGAACTCACACCAGGATTGAGCTCTGGAGGGCTTGAAAATCGACCTATTAATGCAGCAGCTAGAGGGTCAGTGGGAAAAGTATCAGAAACCAGAGCAAAGCAAGAATTAGCTAAAGAGGAGAAGGCGAAAGAACTTTTTCTTAAGGCAGCAGAGGAGGAACAAAATGGAGCTCTTTACGAAGCTATCAAGTTTTACCGTCAAGCAATGCAGCTTGTGCCAGACATTGAATTCAAAATTAACTACACCTGGTCTCCTGATGGTGACGGGAAAAATTTCATGGATGATGCTAATAATGACAGCAAAATGGCTGACCTTTTATCTTACTTCCAGCAGCAACTAACATTCCAACAGTCTAAACTTTGTCAGTCAGACATTGATGTCACTCAAACTCATATTTCAGTGCTCCCAATGGAGGTGCTGATGTATATTTTTCGCTGGGTGGTATCCAGTGACCTTGATCTCCGAGCACTGGAGCAACTTTCCTTGGTCTGCAAGGGCTTTTATATTTGTGCAAGAGACCCAGAGATCTGGCGCCTGGCATGCCTGAAAGTATGGGGCCGAAACTGTGTAAAAATTCTCCCCTATACCACCCGGGAAGCAGATGTTTCCTGGAAAAACCACGAATTCCAATTTGATGGGGGTATATATCAGGTAAAAACCACATTTTTTACTTTCAAGGGAAAAAACAATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAAGGTGATGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839298
dbEST ID: 79657000
Trimmed Sequence: AAGAGGCCTTTCTGACACAGCAGTGAAGCTTTTCACACGAGCAAAAAACAGTGGCGTGTACATCTTGTCAATTTCAAATGCTGTAACAGCTGTCTCTCCAGTTGATTTGTAAGTAATGTGACAAGAATGGTGGATCCAGGCAAGCTTGTTAAATCTGTGACGTCCGCTGGAACAAAGCTGTAGACCCATGTGAAAGCTGCGTTCTGTTTCCGGAACTTGGGGTCGACGGAAATAACGATATTTCTGATAGTCACTTGGTTTCTCCTCTTTCTTGTTGGTTATTACAGCAAATACTTTGGTTTGGTTGTCTGTTTCTTGAGAAAGGCGGTAGTGGCCAAACAGCATTGCGTCAGTTCTTGCATTTCTTGTCCGCAAACGAGGAACAATTGTTTGGGGATCTTCAGGTGTAGTCAGCATAATAACATGCCCATCAGGGAAAAATCTCAAATATCTATAATATTCCACTTGATGCCATGCACGATAAAATCCATCCAAAGACTGCTCTCCCTGACGTATATATGTGGTCTTACTGATATATACCCCATCAAATCGAACTCGTGGTCTTTCCAGGAACATCTGCCTCCAGGTGGTATAGGGGGAGAATTTTTACACCAGTTTCGGGCCCCATACTTTTCAGGCAATGCCAGGCGCCCAGATCTCTGGGGTCTTCTGGCACAAAAAAAAAAAGCCCCTTGCGAAACCAAGGAAAAGTTTGCTCCCCGTGGCCTCGAAAAAATAAAGGGTCCCCCGGGAAACCCCACCCCAGGCCAAAAAAAAAAACCCTTCAAACCA
Full Trace Sequence: ACGAGAAACAGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGAGGCCTTTCTGACACAGCAGTGAAGCTTTTCACACGAGCAAAAAACAGTGGCGTGTACATCTTGTCAATTTCAAATGCTGTAACAGCTGTCTCTCCAGTTGATTTGTAAGTAATGTGACAAGAATGGTGGATCCAGGCAAGCTTGTTAAATCTGTGACGTCCGCTGGAACAAAGCTGTAGACCCATGTGAAAGCTGCGTTCTGTTTCCGGAACTTGGGGTCGACGGAAATAACGATATTTCTGATAGTCACTTGGTTTCTCCTCTTTCTTGTTGGTTATTACAGCAAATACTTTGGTTTGGTTGTCTGTTTCTTGAGAAAGGCGGTAGTGGCCAAACAGCATTGCGTCAGTTCTTGCATTTCTTGTCCGCAAACGAGGAACAATTGTTTGGGGATCTTCAGGTGTAGTCAGCATAATAACATGCCCATCAGGGAAAAATCTCAAATATCTATAATATTCCACTTGATGCCATGCACGATAAAATCCATCCAAAGACTGCTCTCCCTGACGTATATATGTGGTCTTACTGATATATACCCCATCAAATCGAACTCGTGGTCTTTCCAGGAACATCTGCCTCCAGGTGGTATAGGGGGAGAATTTTTACACCAGTTTCGGGCCCCATACTTTTCAGGCAATGCCAGGCGCCCAGATCTCTGGGGTCTTCTGGCACAAAAAAAAAAAGCCCCTTGCGAAACCAAGGAAAAGTTTGCTCCCCGTGGCCTCGAAAAAATAAAGGGTCCCCCGGGAAACCCCACCCCAGGCCAAAAAAAAAAACCCTTCAAACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAGGCCTTTCTGACAC