ORFeome > fen1 ORF1 – XORFeome v1.0

fen1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fen1
Gene ID: 955523
Gene Page ID: 955517
ORF Xenbase ID: 17275743

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124977
Original XGC clone length: 1149

Human orthology & disease relationships

NCBI Entrez ID: 2237
Ensembl gene IDs: ENSG00000168496
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 151623,194050,210900,214150,216400,223100,259500,275355,277700,278300,278780,600462,601675,605258

Library Location

Plate ID: GDExl11083
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ837457
dbEST ID: 79655159
Trimmed Sequence: ATGGGAATTCACGGTTTGGCCAAACTTATCGCAGATGTGGCACCTGCAGCTATCAAAGAGCATGATATAAAAAGTTACTTTGGTCGAAAGGTGGCGATCGATGCTTCCATGTGCATTTATCAGTTTCTTATTGCAGTGAGACAGGATGGCAACACGCTGCAAAACGAAGAAGGTGAAACCACAAGCCATCTTATGGGTATGTTTTACCGTACCATTCGCATGGTAGAGCATGGCATCAAACCAGTGTATGTGTTTGATGGGAAGCCGCCACAGATGAAGTCCGGTGAACTAGCCAAACGCAGTGAGCGTAGGGCCGAGGCAGAGAAGTTGCTTGAAGCTGCCGAGGAGGCTGGAGAAGTGGAGAACATTGAGAAGTTCACTAAAAGACTTGTCAAGGTCACCAAGCAGCACAATGAGGAGTGCAAGAAATTACTTACCCTAATGGGCATTCCTTATGTGGATGCACCCTGTGAAGCTGAGGCCACGTGTGCTGCCTTAGTAAAAGCAGGGAAAGTGTATGCTGCAGCAACAGAAGACATGGATGCCCTGACCTTTGGCACCCCTGTGCTCCTTAGGCACCTCACAGCAAGCGAAGCTAANAAGCTGCCTATTCAGGAGTTCCATCTAAACCGTGTCATTCAGGACATAGGTATCACACATGAACAATTTGTGGATCTCTGTACCTTGCTCGGAATTGACTACTGGTGAAAACCATCCGTGGCATTTGAACCCAAAAGAGCCATTTGAACCTGATCCGTCGCCATAAGAACCATTGACCAAGAACATTTAAAAACATTGAACCTCCAGAAAAAAACC
Full Trace Sequence: CGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAATTCACGGTTTGGCCAAACTTATCGCAGATGTGGCACCTGCAGCTATCAAAGAGCATGATATAAAAAGTTACTTTGGTCGAAAGGTGGCGATCGATGCTTCCATGTGCATTTATCAGTTTCTTATTGCAGTGAGACAGGATGGCAACACGCTGCAAAACGAAGAAGGTGAAACCACAAGCCATCTTATGGGTATGTTTTACCGTACCATTCGCATGGTAGAGCATGGCATCAAACCAGTGTATGTGTTTGATGGGAAGCCGCCACAGATGAAGTCCGGTGAACTAGCCAAACGCAGTGAGCGTAGGGCCGAGGCAGAGAAGTTGCTTGAAGCTGCCGAGGAGGCTGGAGAAGTGGAGAACATTGAGAAGTTCACTAAAAGACTTGTCAAGGTCACCAAGCAGCACAATGAGGAGTGCAAGAAATTACTTACCCTAATGGGCATTCCTTATGTGGATGCACCCTGTGAAGCTGAGGCCACGTGTGCTGCCTTAGTAAAAGCAGGGAAAGTGTATGCTGCAGCAACAGAAGACATGGATGCCCTGACCTTTGGCACCCCTGTGCTCCTTAGGCACCTCACAGCAAGCGAAGCTAANAAGCTGCCTATTCAGGAGTTCCATCTAAACCGTGTCATTCAGGACATAGGTATCACACATGAACAATTTGTGGATCTCTGTACCTTGCTCGGAATTGACTACTGGTGAAAACCATCCGTGGCATTTGAACCCAAAAGAGCCATTTGAACCTGATCCGTCGCCATAAGAACCATTGACCAAGAACATTTAAAAACATTGAACCTCCAGAAAAAAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAATTCACGGTTTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837456
dbEST ID: 79655158
Trimmed Sequence: TTTACCCCTCTTGAACTTTCCTGCAGGGGTACCTCCAGTTTTGGCTTTCTTTTTAGCGGATCCTTTGGATTCTGCCTCTTTTCTTTTAGTTGAGCTAACGGATCCGGTCACTTTGAAAAAGTCATCCAGCCGGCCCTGTGTGCTGCCTTGCCGGTTCTTGGCCAACTTTTTGGCCCCGTTGCGTATGCGATCTTCACTAAACTGCTTCTCCCCACACATGAAGGCCACCAATCCTTCTTCATCGGGCTCGATCCACTTCAGCTCGGTGATGTCAGTGTCGACTACTTCTGGTTCCAAGAAAAGATGTTTTGCCTCCTTGTGCAGCCAGTTTTCCGGAACGGGGTATTTCTTGAGGTCAATGTTATCAATGATCTCGTCAATGGTCTTATGCTGACGGATCAGGTCAATGGCTCTTTTGCGTCCGGTGCCACGGATGGTTTCGCACTAGTCACTTCCCAGCAAGATACAGAGATCCACAAATTTTTCATAGTGTGATGAGTATGTCTTTTAGGACACAGGTTAGAGGTAACTCCCTGAAACACGGCTCTTGGATTTCTCTTGCTGCTATGTGCGGTAGGGAGCCAGGGGGTGGCGAAAGGGGGGGGAGGGATGGCATCCATTGTTGGCTGGGTAGTTTTTCTTCCTTTTTTCGGAGGGGACAACCGGGGCGCCCCCCTGCGCGGGGTGGGTCCAGGGCGGGCGAAGGCCCACTGGAAAGGGGAAGAAATAAGTAGAGGAAGCGGACATTTATCGCGGCCTTCTCAGGGGGGGGGGCCGAGG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTACCCCTCTTGAACTTTCCTGCAGGGGTACCTCCAGTTTTGGCTTTCTTTTTAGCGGATCCTTTGGATTCTGCCTCTTTTCTTTTAGTTGAGCTAACGGATCCGGTCACTTTGAAAAAGTCATCCAGCCGGCCCTGTGTGCTGCCTTGCCGGTTCTTGGCCAACTTTTTGGCCCCGTTGCGTATGCGATCTTCACTAAACTGCTTCTCCCCACACATGAAGGCCACCAATCCTTCTTCATCGGGCTCGATCCACTTCAGCTCGGTGATGTCAGTGTCGACTACTTCTGGTTCCAAGAAAAGATGTTTTGCCTCCTTGTGCAGCCAGTTTTCCGGAACGGGGTATTTCTTGAGGTCAATGTTATCAATGATCTCGTCAATGGTCTTATGCTGACGGATCAGGTCAATGGCTCTTTTGCGTCCGGTGCCACGGATGGTTTCGCACTAGTCACTTCCCAGCAAGATACAGAGATCCACAAATTTTTCATAGTGTGATGAGTATGTCTTTTAGGACACAGGTTAGAGGTAACTCCCTGAAACACGGCTCTTGGATTTCTCTTGCTGCTATGTGCGGTAGGGAGCCAGGGGGTGGCGAAAGGGGGGGGAGGGATGGCATCCATTGTTGGCTGGGTAGTTTTTCTTCCTTTTTTCGGAGGGGACAACCGGGGCGCCCCCCTGCGCGGGGTGGGTCCAGGGCGGGCGAAGGCCCACTGGAAAGGGGAAGAAATAAGTAGAGGAAGCGGACATTTATCGCGGCCTTCTCAGGGGGGGGGGCCGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTACCCCTCTTGAACTTTCCT