ORFeome > fezf2 ORF1 – XORFeome v1.0

fezf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fezf2
Gene ID: 1006438
Gene Page ID: 1006431
ORF Xenbase ID: 17275767

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110761
Original XGC clone length: 1305

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ837990
dbEST ID: 79655692
Trimmed Sequence: ATGTCTGCGCCTTTAGAGACGGTCATGAGCCCCTGCCAGAGATTGGACGCGAGGACTGGGGCTGCTGCTCCCCCCAAGAGCCTGGCTTTCTCCATAGAGAGAATTATGGCCAAGACTTCAGAGCCCAGGGCTGGTGTGTTTGAAGCCAACCAAGGACTGGAGTCAGGCGCAAAGAAAACGCTAAATGTTTGCCCCCCTGTGCCCTGTATGATCCCCATTCAGTCTCTGGCCTATGATGTGAGCCCCAAGGCGCTGCTGAACTACTCGGAGCTGTGGAGAAGCAGCATCAGGGGGTCGCTGTGTGGCCCCTCCGCTCTCTGCAAATCCAACTGCGGAATCTGCTGCAAAAACGACTTTAACTTGAGTCAGTCGCTTGCGCCCAGCGGCAGAGTCATCAAACCTCAGGTCATTAACCAAACTCTGGGGATGCCCAGCAGCGGCTCCTTCTATTACTTCAACTACCTGGAATCTTCCTTCCACCCGCCTGACCTCCTCAACGGCCAGTTGCTCTCCTCCCGCCTCATAAACGCTCAATCCCAAGCGACACTTTCCGCGCATCACAAACTATTCCTGCTGGACAATTCCCAACTCTCTGCTCTGGCCGCCGACAGATTCCCCACCCCCAATTTCCCCATTAAAAAAGACTCCACGGGCCACCTGGACCATGTGATGAAGGGAAAACTCGGCCCCTGACGGACGGAACCCGGGCAAAACCCCCCCTAACCTCCACCCCTAAATTCCGGGGGAAGGGGGGGGCGAGGGGCTTCTCCCTTGTTAAAATTCCTCCGGAAAGGTTGGTTTGGAGGGCCCCGGTTTTTATATCC
Full Trace Sequence: TCGAGGGCCATAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGCGCCTTTAGAGACGGTCATGAGCCCCTGCCAGAGATTGGACGCGAGGACTGGGGCTGCTGCTCCCCCCAAGAGCCTGGCTTTCTCCATAGAGAGAATTATGGCCAAGACTTCAGAGCCCAGGGCTGGTGTGTTTGAAGCCAACCAAGGACTGGAGTCAGGCGCAAAGAAAACGCTAAATGTTTGCCCCCCTGTGCCCTGTATGATCCCCATTCAGTCTCTGGCCTATGATGTGAGCCCCAAGGCGCTGCTGAACTACTCGGAGCTGTGGAGAAGCAGCATCAGGGGGTCGCTGTGTGGCCCCTCCGCTCTCTGCAAATCCAACTGCGGAATCTGCTGCAAAAACGACTTTAACTTGAGTCAGTCGCTTGCGCCCAGCGGCAGAGTCATCAAACCTCAGGTCATTAACCAAACTCTGGGGATGCCCAGCAGCGGCTCCTTCTATTACTTCAACTACCTGGAATCTTCCTTCCACCCGCCTGACCTCCTCAACGGCCAGTTGCTCTCCTCCCGCCTCATAAACGCTCAATCCCAAGCGACACTTTCCGCGCATCACAAACTATTCCTGCTGGACAATTCCCAACTCTCTGCTCTGGCCGCCGACAGATTCCCCACCCCCAATTTCCCCATTAAAAAAGACTCCACGGGCCACCTGGACCATGTGATGAAGGGAAAACTCGGCCCCTGACGGACGGAACCCGGGCAAAACCCCCCCTAACCTCCACCCCTAAATTCCGGGGGAAGGGGGGGGCGAGGGGCTTCTCCCTTGTTAAAATTCCTCCGGAAAGGTTGGTTTGGAGGGCCCCGGTTTTTATATCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGCGCCTTTAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837989
dbEST ID: 79655691
Trimmed Sequence: ACTCTGTCCAGTCCTGGAGATTTCCTTGTGGGAACAAGAGGATGAAACGTTGTCGTGTAATTTCCTGACGTGTTTTTTCAGGTCGAAGTTCCTGCAAAATCCTTTGCCGCAAGTGGCGCAAGTGAAGGGCTTCTTGTCGTTGTGTGTGTGCATGTGGAACGTCAGATTGTAGACTTGATGGAAGGCTTTGTTACAGATACTGCACTTGTACTGCTTCTCTCCACTGTGGGTCAGTTTGTGGTTTTTATAATTCCCTTTTTGGTGAAATCCCTTCCCGCACAATTCACAAACAAAGGGTTTGTAGCCCGCGTGGATCGTGATGTGAGTGTTCGGCCTGGAGCGTCTGTTAAACGCTTTGCCGGACTGGATACATTTGTGGGGGTTGTCCTGCCCGGGGAGGATAATATGTCTGCACAGAGTAGAATCCTCCCGAGGGCATATAGACCTGCACGATAAGTAAAAAGACAAGGGGGGGGGGTCGGACTGGGGGGGGGGGGGGTACATTGTATTCGGAAGGGGGGGAGGAGCGGGTGACAACACAACTGACTATTGTAAATAGCGGGGGCTCCCCTCCCAAGGTGAATGGGAGAAAAATTTAAGAGAGGTTCCTGGGCGGGTGGCGGAAGGGAAAAGAGGGGCACTGGGGGGGGGGACGGGGGGGGGGTGGGGGGGGGGGCCAGTGATTTTTGGGGGGGGATGGGGGGGGGGGGGGAAGCTCTCGGGGGGCGGCACTAGGAGGGGGGGGGGGGGGGGGGTGGGGTGCGGGACGG
Full Trace Sequence: GAAAGGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTCTGTCCAGTCCTGGAGATTTCCTTGTGGGAACAAGAGGATGAAACGTTGTCGTGTAATTTCCTGACGTGTTTTTTCAGGTCGAAGTTCCTGCAAAATCCTTTGCCGCAAGTGGCGCAAGTGAAGGGCTTCTTGTCGTTGTGTGTGTGCATGTGGAACGTCAGATTGTAGACTTGATGGAAGGCTTTGTTACAGATACTGCACTTGTACTGCTTCTCTCCACTGTGGGTCAGTTTGTGGTTTTTATAATTCCCTTTTTGGTGAAATCCCTTCCCGCACAATTCACAAACAAAGGGTTTGTAGCCCGCGTGGATCGTGATGTGAGTGTTCGGCCTGGAGCGTCTGTTAAACGCTTTGCCGGACTGGATACATTTGTGGGGGTTGTCCTGCCCGGGGAGGATAATATGTCTGCACAGAGTAGAATCCTCCCGAGGGCATATAGACCTGCACGATAAGTAAAAAGACAAGGGGGGGGGGTCGGACTGGGGGGGGGGGGGGTACATTGTATTCGGAAGGGGGGGAGGAGCGGGTGACAACACAACTGACTATTGTAAATAGCGGGGGCTCCCCTCCCAAGGTGAATGGGAGAAAAATTTAAGAGAGGTTCCTGGGCGGGTGGCGGAAGGGAAAAGAGGGGCACTGGGGGGGGGGACGGGGGGGGGGTGGGGGGGGGGGCCAGTGATTTTTGGGGGGGGATGGGGGGGGGGGGGGAAGCTCTCGGGGGGCGGCACTAGGAGGGGGGGGGGGGGGGGGGTGGGGTGCGGGACGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTCTGTCCAGTCCTGGAGATT