ORFeome > fgg ORF1 – XORFeome v1.0

fgg ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fgg
Gene ID: 478359
Gene Page ID: 478354
ORF Xenbase ID: 17275845

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054185
Original XGC clone length: 1320

Human orthology & disease relationships

NCBI Entrez ID: 2266
Ensembl gene IDs: ENSG00000171557
Directly associated (OMIM) disease MIM numbers: 202400,616004
Indirectly associated (Lage, et al.) disease MIM numbers: 188050,188055,202400,217090,226650,226730,231200,273800

Library Location

Plate ID: GDExl11001
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ839140
dbEST ID: 79656842
Trimmed Sequence: ATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAANAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAAAAAGGTTTTGGATATCTGTCACCAAACGAACAAGACTTGAGTTCTTGGCTTGGGGAATGAAA
Full Trace Sequence: TCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCAGACTTCCCAAGCAAGGATTACTGCTTCTCCAGTCCTTAGCCCTCCTCTCTAGTGCCTTTGGTAATATTATACCAAACACAGACAACTGCTGCATCTTAGATGGACGTTTTGGGGAGTACTGCCCTACAACATGCGGCATTTCCGATTTCCTGAACAGATACCAAGAAAATGTTGACACAGACTTGCAGTACCTGGAAAACCTTTTAACTCAAATCAGCAACTCCACAAGTGGAACTACCATAATAGTAGAACATTTAATAGACTCTGGGAAAAAACCTGCGACATCTCCACAAACAGCCATAGACCCTATGACTCAGAAATCCAAAAACATGTTGGATGAAATTAACAGATATGAAAAAACTATTATCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGCCGAGATACAGTTCAGATACAGGAGTTCACAGGAAAAGACTGTCAAGAAGTTGCTAATAAGGGAGCAAGGCTTAGCGGACTCTACTACATCAAGCCTCTAANAGCCAAACAGCAGTTCCTGGTTTACTGTGAAATTGAACCATCTGGCAGTGCATGGACTGTTATTCAAAGAAGACTTGATGGCAGTGTGAATTTCCATAAGAACTGGGTCCAGTATAGAAAAAGGTTTTGGATATCTGTCACCAAACGAACAAGACTTGAGTTCTTGGCTTGGGGAATGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCAGACTTCCCAAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839139
dbEST ID: 79656841
Trimmed Sequence: AAAGTCTCCTCTGTTTTCAAAGTCAGACTTCTTTGAGCCGCCCAAAGTCTGCTGTCCTTCTGCTCCATATCTGTTAAGGGGAATGATTTTCATTGTAACTGACTTCATGGAGTACCACCGGCTTCTCCAGGTAGCCCAGATAATACCATTATCATAGCCGCTAGGTCCACTGTCCGCCTCACTGTATGTACCTCCTTGATAGTATTTACCATTGAGGTGGGCTGCATGGCATCGGTTCATCCACCACCCAGAGCCATCTTGCTCAGCACAGTTTCCGTCAAACTTGTCATTGTCTTTATCAAAAGTACTGAACTGCATTCCATTGTGAGATGTGTAGAATTTATCACTTGGATCATCTCCAAAGTCAAACCCATCAAAGGCATCACCGGCATCACCACCAATGAAGTATGCGTAAGTAAAACGATAATTATCCTTTTCTGAACCCAGTCTGAAAGTGGAATAGTCTGCTGTGCTCTTTTGATTACTCCAGTCTTCTAACTCAATTCTCATAACATATGGGATGGTAGATTGGGTGCTTAGTAGATGTATTTTTTCATTCCCAAGCCAGAACTCAGTCTTGTCGTTTGGTGACAGATATCCAAAACCTTCTCTATACGGGACCCAGTTCCTATGGGAATTTCCACTGGCCATCAATTCTTCTTTTGAAAACAATCCAATGCACTGGCCAAATGGGTTTAATTTTCACAGTAAAACCCAGGAACCTGCTGGTTTGGGCTTTTTTAAAAAGGCTTGGAATGTAAAAAA
Full Trace Sequence: GGGGAATATGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGTCTCCTCTGTTTTCAAAGTCAGACTTCTTTGAGCCGCCCAAAGTCTGCTGTCCTTCTGCTCCATATCTGTTAAGGGGAATGATTTTCATTGTAACTGACTTCATGGAGTACCACCGGCTTCTCCAGGTAGCCCAGATAATACCATTATCATAGCCGCTAGGTCCACTGTCCGCCTCACTGTATGTACCTCCTTGATAGTATTTACCATTGAGGTGGGCTGCATGGCATCGGTTCATCCACCACCCAGAGCCATCTTGCTCAGCACAGTTTCCGTCAAACTTGTCATTGTCTTTATCAAAAGTACTGAACTGCATTCCATTGTGAGATGTGTAGAATTTATCACTTGGATCATCTCCAAAGTCAAACCCATCAAAGGCATCACCGGCATCACCACCAATGAAGTATGCGTAAGTAAAACGATAATTATCCTTTTCTGAACCCAGTCTGAAAGTGGAATAGTCTGCTGTGCTCTTTTGATTACTCCAGTCTTCTAACTCAATTCTCATAACATATGGGATGGTAGATTGGGTGCTTAGTAGATGTATTTTTTCATTCCCAAGCCAGAACTCAGTCTTGTCGTTTGGTGACAGATATCCAAAACCTTCTCTATACGGGACCCAGTTCCTATGGGAATTTCCACTGGCCATCAATTCTTCTTTTGAAAACAATCCAATGCACTGGCCAAATGGGTTTAATTTTCACAGTAAAACCCAGGAACCTGCTGGTTTGGGCTTTTTTAAAAAGGCTTGGAATGTAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGTCTCCTCTGTTTTCAAAGTC