ORFeome > fhl1 ORF1 – XORFeome v1.0

fhl1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fhl1
Gene ID: 964262
Gene Page ID: 964256
ORF Xenbase ID: 17275869

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC078615
Original XGC clone length: 843

Human orthology & disease relationships

NCBI Entrez ID: 2273
Ensembl gene IDs: ENSG00000022267
Directly associated (OMIM) disease MIM numbers: 300695,300696,300717,300718
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ839832
dbEST ID: 79657534
Trimmed Sequence: ATGTCCGGAAGTTTTGATTGCCACTACTGCAGAGCCCCGCTCCAAGGAAAAAAATATATTGAGAAGGATGGACACAACACCTGCGTGAAGTGTTTTGACAAAATATGTGCCAACACCTGTGCAGAGTGCAGGAAGCCTATTGGAGTGGATTCCAAGGAGCTGCATTATAAGAACCGATACTGGCACGATACCTGCTTCCGCTGTGCTAAATGCTATCACCCTCTGGCCAATGAGCAATTCATTGCTAAAGACAATAAAATCCTGTGCTCCAAGTGTACCACCAAGGAGGACTCCCTTCGCTGCAGTGGCTGCCACAAGCAGATCCAACCAGGAGGACGCAATGTTGAATACAAGGGCAGCGCCTGGCATGAGGAATGTTTTACCTGCAGTAACTGCAAGCAGGCCATTGGAGCAGGAAGCTTCTTTCCCAAGGGAACCGATGTCTACTGTGTGACATGCCATGAGCAAAAATTTGCCAAGCATTGTGTAAAGTGCAACAAACCCATTGCTTCTGGTGGCATAACATACCAAGATCAGCCTTGGCACGGTGACTGCTTTGTGTGTGAAACCTGCCATAAGAAGCTCGCTGGCCAGCGCTTCACTGCATTGAAGGATCAGTACTACTGGTGTGGAATGCTACAAAGCCTTTGTTGGCCAGAAGTGCCTCTGGAATGTACAACCCCTCCCAGGGTTTTGGAAAAAGATTCATGGTTGGTCACCCATGAAGGGAAAACCTGGGCATAAAAACGGTTTTACCCTCAAAAAAGTGCCTCTCTTTAACTTGGGCTAAAAACCCCTTTGTTCCCCCAAAAGAGACCCAATTTAAATTGCAAAAAAG
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAAGTTTTGATTGCCACTACTGCAGAGCCCCGCTCCAAGGAAAAAAATATATTGAGAAGGATGGACACAACACCTGCGTGAAGTGTTTTGACAAAATATGTGCCAACACCTGTGCAGAGTGCAGGAAGCCTATTGGAGTGGATTCCAAGGAGCTGCATTATAAGAACCGATACTGGCACGATACCTGCTTCCGCTGTGCTAAATGCTATCACCCTCTGGCCAATGAGCAATTCATTGCTAAAGACAATAAAATCCTGTGCTCCAAGTGTACCACCAAGGAGGACTCCCTTCGCTGCAGTGGCTGCCACAAGCAGATCCAACCAGGAGGACGCAATGTTGAATACAAGGGCAGCGCCTGGCATGAGGAATGTTTTACCTGCAGTAACTGCAAGCAGGCCATTGGAGCAGGAAGCTTCTTTCCCAAGGGAACCGATGTCTACTGTGTGACATGCCATGAGCAAAAATTTGCCAAGCATTGTGTAAAGTGCAACAAACCCATTGCTTCTGGTGGCATAACATACCAAGATCAGCCTTGGCACGGTGACTGCTTTGTGTGTGAAACCTGCCATAAGAAGCTCGCTGGCCAGCGCTTCACTGCATTGAAGGATCAGTACTACTGGTGTGGAATGCTACAAAGCCTTTGTTGGCCAGAAGTGCCTCTGGAATGTACAACCCCTCCCAGGGTTTTGGAAAAAGATTCATGGTTGGTCACCCATGAAGGGAAAACCTGGGCATAAAAACGGTTTTACCCTCAAAAAAGTGCCTCTCTTTAACTTGGGCTAAAAACCCCTTTGTTCCCCCAAAAGAGACCCAATTTAAATTGCAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAAGTTTTGATTGCCA

Sequences - 3ʹ (reverse) EST

Accession: JZ839831
dbEST ID: 79657533
Trimmed Sequence: CAGTTTTTTGGCACAGTCTTGACAGTAAACTTGCTCATTATGGCGTACAAAGCGCTTGTTAGCCAGGTTAAGAGAGCACTTTTTGCAGGTGAAACAGTATTCATGCCAGGTATTGCCTTCATGGTTGACAACACTGGATCCTTTTCCAAACCCTGTGATGGGGTTGTTACATCCAGAGCACTTCTTGGCCACAAAGGCTTTGTAGCAATCCACACAGTAGTACTGATCCTCCACTGCAGTGAAGCGCTGGCCAGCGAGCTTCTTATGGCAGGTTTCACACACAAAGCAGTCACCGTGCCAAGGCTGATCTTGGTATGTTATGCCACCACAAGCAATGGGTTTGTTGCACTTTACACAATGCTTGGCAAATTTTTGCTCATGGCATGTCACACAGTAGACATCGGTTCCCTTGGGAAAGAAGCTTCCTGCTCCAATGGCCTGCTTGCAGTTACTGCAGGTAAAACATTCCTCATGCCAGGCGCTGCCCTTGTATTCAACATTGCGTCCTCCTGGTTGGATCTGCTTGTGGCAGCCACTGCAGCGAACGGAGTCCTCCTTGCTGGTACACTTGGAGCACAGGAATTTATTGTCTTTAGCAATGAATTGCTCAATTGGCCAAATGGTGATAGCATTTTAGCACAGCGGTAAACAGGTATCGTGGCCAGTATCCGTTCCTTATAAAGCAACCTCCTGGAAATCAAACTCCAATAGGCTTTCCTGCACTCTTCCACAAGTTGTTTGGCCCAAAATTTTTATCAAAACCCCTTCAACCCCGCT
Full Trace Sequence: GCACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTTTTTTGGCACAGTCTTGACAGTAAACTTGCTCATTATGGCGTACAAAGCGCTTGTTAGCCAGGTTAAGAGAGCACTTTTTGCAGGTGAAACAGTATTCATGCCAGGTATTGCCTTCATGGTTGACAACACTGGATCCTTTTCCAAACCCTGTGATGGGGTTGTTACATCCAGAGCACTTCTTGGCCACAAAGGCTTTGTAGCAATCCACACAGTAGTACTGATCCTCCACTGCAGTGAAGCGCTGGCCAGCGAGCTTCTTATGGCAGGTTTCACACACAAAGCAGTCACCGTGCCAAGGCTGATCTTGGTATGTTATGCCACCACAAGCAATGGGTTTGTTGCACTTTACACAATGCTTGGCAAATTTTTGCTCATGGCATGTCACACAGTAGACATCGGTTCCCTTGGGAAAGAAGCTTCCTGCTCCAATGGCCTGCTTGCAGTTACTGCAGGTAAAACATTCCTCATGCCAGGCGCTGCCCTTGTATTCAACATTGCGTCCTCCTGGTTGGATCTGCTTGTGGCAGCCACTGCAGCGAACGGAGTCCTCCTTGCTGGTACACTTGGAGCACAGGAATTTATTGTCTTTAGCAATGAATTGCTCAATTGGCCAAATGGTGATAGCATTTTAGCACAGCGGTAAACAGGTATCGTGGCCAGTATCCGTTCCTTATAAAGCAACCTCCTGGAAATCAAACTCCAATAGGCTTTCCTGCACTCTTCCACAAGTTGTTTGGCCCAAAATTTTTATCAAAACCCCTTCAACCCCGCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTTTTTTGGCACAGTCTTG