ORFeome > figf ORF1 – XORFeome v1.0

figf ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: figf
Gene ID: 865695
Gene Page ID: 487324
ORF Xenbase ID: 17275893

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124876
Original XGC clone length: 1026

Human orthology & disease relationships

NCBI Entrez ID: 2277
Ensembl gene IDs: ENSG00000165197
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,123500,125853,131760,131800,131900,131960,153100,179850,211980,246200,605074,607685,608747,609040,609352

Library Location

Plate ID: GDExl11088
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ838275
dbEST ID: 79655977
Trimmed Sequence: ATGATTAGACCGTGGGCAATTGCAAACCTTTTTGTGTTTTCGTTGCATCTTCTTCAGGGATTTGACAATGAGAATATGAAGGGAACATCCCAGAACGAGCTGGAGATGAAAATCAGATCTGCTGCAAATCTCGAGGAGTTTCTTCGAATAACTCATCCCAGGGAGCTGAAACTTTGGAGATGCAGATCAAAGCTTAAATCCTACATTGGCTCAGATTCCAGGTCTGCTTCCCATCGCTCAACACGTTTTGCAGCTGCTTTCTATGACATTGAAATATTGAAGGTTATAGATGAGGAATGGCAGAAGACTCAGTGTATTCCCAGGGAAACTTGTGTGGATGTTGGAAAGGACCTTGGCACCTCAACCAACACCTTTTTCAAGCCTCCCTGTGTATCAGTGTTTAGATGCGGAGGCTGCTGCAACGAAGAAGGAATCTCATGTGTAAACACGAGCACTTCATATGTTTTCAAGACGCTTTTTGAAATCTCGGTTCCATTAACACAAGCACCAGAACCCGTAACCATCAAAATAGCCGATCACACAAGCTGCAAATGCACGCCGAGTTCTCCACGGCTTTCGAAGGCCATTATACGAAGATCTGTCCACTATCCGGAATACGGTTGCGACCAGGAAGATACAAGCTGCCCGAATGGATGGCAGTGGGATAGCAACCCGTGTGAGTGTGTGCTTTCAAGGGAGCCAACATCCATAAAAAAAGGGAAAAAAAAGCTATATTTGGGGCCCACATGGGAATTTAAAAACAACTGTTAAAGGTGGTTGCAAACCGAAAAATGTCCCCCACCGTACCCCCAGGTTC
Full Trace Sequence: CGTGGGCCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTAGACCGTGGGCAATTGCAAACCTTTTTGTGTTTTCGTTGCATCTTCTTCAGGGATTTGACAATGAGAATATGAAGGGAACATCCCAGAACGAGCTGGAGATGAAAATCAGATCTGCTGCAAATCTCGAGGAGTTTCTTCGAATAACTCATCCCAGGGAGCTGAAACTTTGGAGATGCAGATCAAAGCTTAAATCCTACATTGGCTCAGATTCCAGGTCTGCTTCCCATCGCTCAACACGTTTTGCAGCTGCTTTCTATGACATTGAAATATTGAAGGTTATAGATGAGGAATGGCAGAAGACTCAGTGTATTCCCAGGGAAACTTGTGTGGATGTTGGAAAGGACCTTGGCACCTCAACCAACACCTTTTTCAAGCCTCCCTGTGTATCAGTGTTTAGATGCGGAGGCTGCTGCAACGAAGAAGGAATCTCATGTGTAAACACGAGCACTTCATATGTTTTCAAGACGCTTTTTGAAATCTCGGTTCCATTAACACAAGCACCAGAACCCGTAACCATCAAAATAGCCGATCACACAAGCTGCAAATGCACGCCGAGTTCTCCACGGCTTTCGAAGGCCATTATACGAAGATCTGTCCACTATCCGGAATACGGTTGCGACCAGGAAGATACAAGCTGCCCGAATGGATGGCAGTGGGATAGCAACCCGTGTGAGTGTGTGCTTTCAAGGGAGCCAACATCCATAAAAAAAGGGAAAAAAAAGCTATATTTGGGGCCCACATGGGAATTTAAAAACAACTGTTAAAGGTGGTTGCAAACCGAAAAATGTCCCCCACCGTACCCCCAGGTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTAGACCGTGGGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838274
dbEST ID: 79655976
Trimmed Sequence: GGGGCTTTCTCTGCTTGGGAGCCAAGATGTTCCTCTTCTCTCTTTGGGACACTGAAAATATTTTGCACATACTTGTTTCCCGTTGGGACATTCTTTTATTTGGAATGGACACTTGTCTTCACAACTGCATGTATCAGGAAAAAATATTTTCTGTTTCTTGGCACAACTTTCTAGTGTCTCCCTACATTCACAGAGGCAGCTCTCTTGGTTCAGAACATGGTGTACGCTGGGACATTTCCGCTTGCACACACATTCACAGTTGTCTTCAAATTCCATGTGGGCCCCACATATAGCTAGTTCTTCCCTTCTTCTACTGATTGTTGGCTCCCTTTGAAGCACACACTCACACAGGTTGCTATCCCACTGCCATCCATTCGGGCAGCTTGTATCTTCCTGGTCGCAACCGTATTCCGGATAGTGGACAGATCTTCGTATAATGGCCTTCGAAAGCCGTGGAGAACTTGGCGTGCATTTGCAGCTTGTGTGATTGGCTATTTTGATGGTTACGGGTTCTGGTGCTTGTGTTAATGGAACCGAGATTTCAAAAAGCGTCTTGAAAACCTATGAAGTGCTCGTGTTTACAATGAGAATCCTTCCTTCTTGCCGCCACCCCCCCATCTAAACACTGATACACAGGGAGGCTTGGAGAGGGTGTTTTGTTTAAGGGTCCGAGGGGCTTTCCAACATCCCCACCAATCTTTCCCCGGGAAATAACACTTGAGTTCGTTCTGCCTATTCCTTCCTTCTTAGAGCCCTTTCATTATTTTTTATTTGT
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGGCTTTCTCTGCTTGGGAGCCAAGATGTTCCTCTTCTCTCTTTGGGACACTGAAAATATTTTGCACATACTTGTTTCCCGTTGGGACATTCTTTTATTTGGAATGGACACTTGTCTTCACAACTGCATGTATCAGGAAAAAATATTTTCTGTTTCTTGGCACAACTTTCTAGTGTCTCCCTACATTCACAGAGGCAGCTCTCTTGGTTCAGAACATGGTGTACGCTGGGACATTTCCGCTTGCACACACATTCACAGTTGTCTTCAAATTCCATGTGGGCCCCACATATAGCTAGTTCTTCCCTTCTTCTACTGATTGTTGGCTCCCTTTGAAGCACACACTCACACAGGTTGCTATCCCACTGCCATCCATTCGGGCAGCTTGTATCTTCCTGGTCGCAACCGTATTCCGGATAGTGGACAGATCTTCGTATAATGGCCTTCGAAAGCCGTGGAGAACTTGGCGTGCATTTGCAGCTTGTGTGATTGGCTATTTTGATGGTTACGGGTTCTGGTGCTTGTGTTAATGGAACCGAGATTTCAAAAAGCGTCTTGAAAACCTATGAAGTGCTCGTGTTTACAATGAGAATCCTTCCTTCTTGCCGCCACCCCCCCATCTAAACACTGATACACAGGGAGGCTTGGAGAGGGTGTTTTGTTTAAGGGTCCGAGGGGCTTTCCAACATCCCCACCAATCTTTCCCCGGGAAATAACACTTGAGTTCGTTCTGCCTATTCCTTCCTTCTTAGAGCCCTTTCATTATTTTTTATTTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGGCTTTCTCTGCTTG