ORFeome > fip1l1 ORF1 – XORFeome v1.0

fip1l1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fip1l1
Gene ID: 985503
Gene Page ID: 985495
ORF Xenbase ID: 17275905

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124845
Original XGC clone length: 1752

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGGGGGCCATATAANTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGTTTCATCGGGGACAAGCGGCAGTACCGCCCCTACTCCCTCCTCACCCACCACCTCCACAGTCGCAACCGCTGTCAGCGTCTCGACGGCGACAGCGGACGGAGGAGGAGGGGGCGGCGGTGATGAGGAAGAGGAATGGCTGTACGGGGAACAAAATGAAGACACGGAAACAGATGATGATGAAAAAGAAGACTTAACAAGCTCTCACCCTGTATCTGGAATCGAAGCAAAAACTTCTTATAATGTTGATGTGACAACGGTGACAGAAACAGACAAATAAATATAAATAGACTGTCATCTACCCGAAAGCCTAGGATTCTGATTATCCACTGGACAGGCCTAGAATGATGCCTCCGCACCTTGGGACTACGTCAACAGAACACAGAAGTAACAGAGATCGTGAAAGGGAGCGAAAGTGTGATACGGATCGAGACAGAGAGCGAGATCGTGATCGAGTCCGTCAGAGGGAACGGGACAGAGAACGTCAATGTGATAACAACCCAGGCACAGGCGCATATAAGACCCAAGGAAGAGCGAAACAGGTACCACGAGTATATCGAGCAGACAGAAAATAACGAAAAGAACTACGAACGTCACCCGAAAAAGAACAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGTTTCATCGGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838178
dbEST ID: 79655880
Trimmed Sequence: ATCGGCATTGGTGGATTCAACACTTTCGGATTCCTGGGCAGGTTCAGCGCCAGCATCTTTCCCTTCTTTGCTTCTTTTGGACTTTTTGTGTTTGTGTCTTCTGTGACTGTCGCCCTCTTCGCTGTCGTGGCGGCGCCTGCTGCTGCTCCGGGATGATTTGTGACGGGGCGCCTCCTCTTTCTCTCGATGACGCCACTCCCGGTGCCTTTCCTCTTTATCACTGTTGATTCACAACTCAGCGATGCTCATACCTCCTTTCCGACCAATCTGTCACCATCATTCACAATATGATCCTTAATTGCTCTCCCACCCTATTACTTGCCCCCGTGCATGAGCTGTGATCACGTTCACGTTCTCAGTCCCGATCCCTCTCACGGACTCGCTCACGATCTCGCTCTCTGTCCCGATCCCTATCACGCTCTCGCTCCCTGTCACGTTCCCTGTCCTTCTCTCTTCTGGGAAAGTAGTCCCCACGGTTTGGAGGCATCTACCAGGGCTGGACCAGGGGAACAGCAGAAACCAGGCATGTGAGGAAAAGAAACGCCTGCATAAGGAAATGCAGGAGCTGAACGCCCATCATAGCCCGAAAAAAGTGACACTTTCTATTGTCGGGGATAAAAGATGGTGGGTGGACCTCGGGGAAGAGGGAGGAAGGACTGNAATGTGCCACCGGTGATGGGGAATGCCGAAATGCGTAATTGTTTTAGGCCTTCCAAAAAAG
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCGGCATTGGTGGATTCAACACTTTCGGATTCCTGGGCAGGTTCAGCGCCAGCATCTTTCCCTTCTTTGCTTCTTTTGGACTTTTTGTGTTTGTGTCTTCTGTGACTGTCGCCCTCTTCGCTGTCGTGGCGGCGCCTGCTGCTGCTCCGGGATGATTTGTGACGGGGCGCCTCCTCTTTCTCTCGATGACGCCACTCCCGGTGCCTTTCCTCTTTATCACTGTTGATTCACAACTCAGCGATGCTCATACCTCCTTTCCGACCAATCTGTCACCATCATTCACAATATGATCCTTAATTGCTCTCCCACCCTATTACTTGCCCCCGTGCATGAGCTGTGATCACGTTCACGTTCTCAGTCCCGATCCCTCTCACGGACTCGCTCACGATCTCGCTCTCTGTCCCGATCCCTATCACGCTCTCGCTCCCTGTCACGTTCCCTGTCCTTCTCTCTTCTGGGAAAGTAGTCCCCACGGTTTGGAGGCATCTACCAGGGCTGGACCAGGGGAACAGCAGAAACCAGGCATGTGAGGAAAAGAAACGCCTGCATAAGGAAATGCAGGAGCTGAACGCCCATCATAGCCCGAAAAAAGTGACACTTTCTATTGTCGGGGATAAAAGATGGTGGGTGGACCTCGGGGAAGAGGGAGGAAGGACTGNAATGTGCCACCGGTGATGGGGAATGCCGAAATGCGTAATTGTTTTAGGCCTTCCAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCGGCATTGGTGGATTCAACACT