ORFeome > fkbp11 ORF1 – XORFeome v1.0

fkbp11 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fkbp11
Gene ID: 966314
Gene Page ID: 966310
ORF Xenbase ID: 17275911

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC078481
Original XGC clone length: 516

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ839716
dbEST ID: 79657418
Trimmed Sequence: ATGTTGTGGGGCTTTGTGCTGCTCCTGCTCCTGTCCCCTGCAACACTCAGGGCAGAAACCCCGGAGGAAGATAGTGAAAATGTTACCGAGCTTGTGATTGAGACGGTGGAGAAGCCGGACTCGTGCACTGAAACTGCAGTTATGGGGGACACCATCCACCTTCACTACACGGGAAGGCTAGAGGATGGGCGGATTATTGACAGTTCACTTTCTCGGGATCCTCTTGTGGTGGAACTTGGAAAGAAACAAGTTATTCCAGGTCTGGAAACAAGTTTGGTAGGCATGTGTGTTGGAGAGAAGCGCAAAGTGGTTATCCCTCCTCACCTGGCCTATGGCAAGAAAGGATACCCTCCTTCTATACCAGGTGACGCTGTGCTGCAGTTTGAGACAGAAGTAATGGCACTGTTCAAGCCCACACCCTGGCAGACCATAGTGAATGATGTTTTCCCTTTACTGCATTGGTTTGGTACCCACGCTTTTGGGGCTTATTGGCTATCACTTGTACTCCAAATCTT
Full Trace Sequence: GCCCCCAAATAATAGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGTGGGGCTTTGTGCTGCTCCTGCTCCTGTCCCCTGCAACACTCAGGGCAGAAACCCCGGAGGAAGATAGTGAAAATGTTACCGAGCTTGTGATTGAGACGGTGGAGAAGCCGGACTCGTGCACTGAAACTGCAGTTATGGGGGACACCATCCACCTTCACTACACGGGAAGGCTAGAGGATGGGCGGATTATTGACAGTTCACTTTCTCGGGATCCTCTTGTGGTGGAACTTGGAAAGAAACAAGTTATTCCAGGTCTGGAAACAAGTTTGGTAGGCATGTGTGTTGGAGAGAAGCGCAAAGTGGTTATCCCTCCTCACCTGGCCTATGGCAAGAAAGGATACCCTCCTTCTATACCAGGTGACGCTGTGCTGCAGTTTGAGACAGAAGTAATGGCACTGTTCAAGCCCACACCCTGGCAGACCATAGTGAATGATGTTTTCCCTTTACTGCATTGGTTTGGTACCCACGCTTTTGGGGCTTATTGGCTATCACTTGTACTCCAAATCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGAAAAATAGCTGTTTACTGGCACCTCTGGCCCGGTCTCAATACCCCAAAAAAGAAACAAANCCCNNTTTCNGACTGCCCCCTTTTTTTTTTGTGGTTTTTCTGGAGAAGACCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGTGGGGCTTTGTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839715
dbEST ID: 79657417
Trimmed Sequence: GATTTGGAGTACAAGTGATAGCCAATAAGCCCCAAAAGCGTGGGTACCAAACCAATGCAGTAAAGGGAAAACATCATTCACTATGGTCTGCCAGGGTGTGGGCTTGAACAGTGCCATTACTTCTGTCTCAAACTGCAGCACAGCGTCACCTGGTATAGAAGGAGGGTATCCTTTCTTGCCATAGGCCAGGTGAGGAGGGATAACCACTTTGCGCTTCTCTCCAACACACATGCCTACCAAACTTGTTTCCAGACCTGGAATAACTTGTTTCTTTCCAAGTTCCACCACAAGAGGATCCCGAGAAAGTGAACTGTCAATAATCCGCCCATCCTCTAGCCTTCCCGTGTAGTGAAGGTGGATGGTGTCCCCCATAACTGCAGTTTCAGTGCACGAGTCCGGCTTCTCCACCGTCTCAATCACAAGCTCGGTAACATTTTCACTATCTTCCTCCGGGGTTTCTGCCCTGAGTGTTGCAGGGGACAGGAGCACGAGCAGCACACAGCCCCACAACATGG
Full Trace Sequence: GAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTTGGAGTACAAGTGATAGCCAATAAGCCCCAAAAGCGTGGGTACCAAACCAATGCAGTAAAGGGAAAACATCATTCACTATGGTCTGCCAGGGTGTGGGCTTGAACAGTGCCATTACTTCTGTCTCAAACTGCAGCACAGCGTCACCTGGTATAGAAGGAGGGTATCCTTTCTTGCCATAGGCCAGGTGAGGAGGGATAACCACTTTGCGCTTCTCTCCAACACACATGCCTACCAAACTTGTTTCCAGACCTGGAATAACTTGTTTCTTTCCAAGTTCCACCACAAGAGGATCCCGAGAAAGTGAACTGTCAATAATCCGCCCATCCTCTAGCCTTCCCGTGTAGTGAAGGTGGATGGTGTCCCCCATAACTGCAGTTTCAGTGCACGAGTCCGGCTTCTCCACCGTCTCAATCACAAGCTCGGTAACATTTTCACTATCTTCCTCCGGGGTTTCTGCCCTGAGTGTTGCAGGGGACAGGAGCACGAGCAGCACACAGCCCCACAACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACAAACAGGTTCCTATCACTCCAAATAAAAACAAATAAATAAAAACAGAACCAAAAAACGGGCCCTTCGTTTTACACATTCCGGGCACAGGGAAAAAAAGTCCTTCATTCCCATCCCCCCCTGTTTTCGTTTTTTAACCTATCGGGGAGAAACCATCTCCAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTTGGAGTACAAGTGATAGC