ORFeome > fkbp2 ORF1 – XORFeome v1.0

fkbp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fkbp2
Gene ID: 958379
Gene Page ID: 958375
ORF Xenbase ID: 17275929

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043844
Original XGC clone length: 426

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ823776
dbEST ID: 79641478
Trimmed Sequence: ATGAACCTCATGTCATTTACACCTCTGTGGTGTTTCCTTATCCTATTCGTGCTGCCTTCTGTCTCATCCAGTGAGGGCAGGAAGAAATTGCAAATTGGAGTGAAGAAGCGTGTAGAAAATTGCCCTGTTAAATCCCGGAAAGGAGACACACTACACATGCATTATACAGGGAAACTGGAGGATGGGACAGAATTTGACAGCAGCATTCCCAGGAATCAGCCGTTTACCTTCACTCTGGGTACCGGACAAGTCATAAAGGGCTGGGACCAAGGGTTACTTGGAATGTGTGAAGGGGAGAAGAGGAAGCTGGTAATACCTTCAGAATTGGGTTATGGAGATAGGGGAGCACCCCCAAAAATTCCAGGAGGAGCCACTCTGATCTTCGAAGTGGAGTTATTGAAGATAGAACGTCGATCTGAACTATT
Full Trace Sequence: GGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACCTCATGTCATTTACACCTCTGTGGTGTTTCCTTATCCTATTCGTGCTGCCTTCTGTCTCATCCAGTGAGGGCAGGAAGAAATTGCAAATTGGAGTGAAGAAGCGTGTAGAAAATTGCCCTGTTAAATCCCGGAAAGGAGACACACTACACATGCATTATACAGGGAAACTGGAGGATGGGACAGAATTTGACAGCAGCATTCCCAGGAATCAGCCGTTTACCTTCACTCTGGGTACCGGACAAGTCATAAAGGGCTGGGACCAAGGGTTACTTGGAATGTGTGAAGGGGAGAAGAGGAAGCTGGTAATACCTTCAGAATTGGGTTATGGAGATAGGGGAGCACCCCCAAAAATTCCAGGAGGAGCCACTCTGATCTTCGAAGTGGAGTTATTGAAGATAGAACGTCGATCTGAACTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCACAATCTCGTAAAATGTAACAGGTTTGGTNNTTGTTTTGTTGGTCGTGGGGGGCTTTTTTTGTTCCCGGTGGTGTTCCTCTTTGTTCCCGCTCCCGGTGGTCGTCTCTTTGTTTTCCCTGTCTGTTTTTTCCCCCGGGGCTTGCTGCTCCCTTGCTCCCGGGCGTGGGGCCTTCCCTTCCCCTTTTGCCCCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACCTCATGTCATTTACACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829085
dbEST ID: 79646787
Trimmed Sequence: TAGTTCAGATCGACGTTCTATCTTCAATAACTCCACTTCGAAGATCAGAGTGGCTCCTCCTGGAATTTTTGGGGGTGCTCCCCTATCTCCATAACCCAATTCTGAAGGTATTACCAGCTTCCTCTTCTCCCCTTCACACATTCCAAGTAACCCTTGGTCCCAGCCCTTTATGACTTGTCCGGTACCCAGAGTGAAGGTAAACGGCTGATTCCTGGGAATGCTGCTGTCAAATTCTGTCCCATCCTCCAGTTTCCCTGTATAATGCATGTGTAGTGTGTCTCCTTTCCGGGATTTAACAGGGCAATTTTCTACACGCTTCTTCACTCCAATTTGCAATTTCTTCCTGCCCTCACTGGATGAGACAGAAGGCAGCACGAATAGGATAAGGAAACACCACAGAGGTGTAAATGACATGAGGTTCATGG
Full Trace Sequence: CCGACAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGTTCAGATCGACGTTCTATCTTCAATAACTCCACTTCGAAGATCAGAGTGGCTCCTCCTGGAATTTTTGGGGGTGCTCCCCTATCTCCATAACCCAATTCTGAAGGTATTACCAGCTTCCTCTTCTCCCCTTCACACATTCCAAGTAACCCTTGGTCCCAGCCCTTTATGACTTGTCCGGTACCCAGAGTGAAGGTAAACGGCTGATTCCTGGGAATGCTGCTGTCAAATTCTGTCCCATCCTCCAGTTTCCCTGTATAATGCATGTGTAGTGTGTCTCCTTTCCGGGATTTAACAGGGCAATTTTCTACACGCTTCTTCACTCCAATTTGCAATTTCTTCCTGCCCTCACTGGATGAGACAGAAGGCAGCACGAATAGGATAAGGAAACACCACAGAGGTGTAAATGACATGAGGTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAATATAAAATCATTATTTGGGGCCCGAGATTAAAACTGGCCGTCGTTTTACACGATGGTGTAACGGGGAAGTTAAGGTGCTGGTGGCGGACTTGTGTTCGGAAATCGTGAGAATCTTCAAGGTAGTGGGATGGGAAAATGGAGAAAACATACATTACCCCAGGTTTCCCTTGACCAAACTGTGATCTCTTTCTGATCCGGTCCAGGGAAATGAAAACCCGCAGGAACGAAATTTTCCGGACAAGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGTTCAGATCGACGTTCTATCTT