ORFeome > fkbp8 ORF1 – XORFeome v1.0

fkbp8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fkbp8
Gene ID: 958354
Gene Page ID: 958350
ORF Xenbase ID: 17275953

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129618
Original XGC clone length: 1227

Human orthology & disease relationships

NCBI Entrez ID: 23770
Ensembl gene IDs: ENSG00000105701
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,124200,228600,236490,300291,300301,300584,308300,600072,603218

Library Location

Plate ID: GDExl11086
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCTCACCGAAGAATCCATCTCCAATATATCTGATATTCATGATCAAGGAGAGAAAAAAGTTGAAATCCATCAAGCTGAGAGGACAGAGTCAAATCCAACTCTTCTGGAGAGCACAGAGGATTTTGAAATAATAGACAGCGCTGTGGAAGAAGATGATCTGAGCGATCTTCCTCTTTTGGAGGATGTAGAGAAGAAGGAGAATCCTGCAGCTGAGAATGATTCTAAAAAACAGCAGACCAATGCCAAGGAGGTACAAGAATGGTTGGATGTCCTAGGTAATGGGATCCTGAAAACGAAGGTTTTAATCTCTGGAAAGGGTGCTGAAAGTATACCAAGAAAAGGATGGGATGTTACTGTGCAACTAATGTCGCTGCTGGAGAATGAAAATGTGGTAGAAGATTCACAATCTCTTACCGTCGAATTGGGAGACGGTGATGACATTCCCGGCCTGGACCTGTGTGTCCTACTCAAGTATGTGGTGGAAACATCCCGCAATGTGTCAGACGCACATACTGGCGGATGAAGGAAGGCGCGAGTCCCAACATTTCGCGCAAATCCCCTTTGATCGCTTGAAGTACCCTGCGGCCAGTTCTTAATGGTCCATATCTTGAAAAACCTTTTTTGAAAGGGAACGGCTGGATTCATGCGAAGTTTTTCGGGTGTCGGGTCAAATTTTCTTTTTCCGACTAGTCAACAAATTTTTTGGGGTTTATTTTCCCTTTAAACAAAAGGCCTTTGAGTGATTGAGATATTTGATGGCCCCGCAAAATGGTTTTTTTTATTTTTCTTAAAGGAAAGAATATACTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCTCTACGGAAGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837838
dbEST ID: 79655540
Trimmed Sequence: GTTACGAGCCGCTATTACGACAGACAGTGCAACACCTCCTATTGCCACAGCTGTTGCCCCAAAAAGCCACTTCCAAGGGATGGACCAAGAAGACTTGGAGGCAGGCTTTGCAGAAGCACTGCTTGGATTCCCCAGCATCTTTTTGTACATGGCACTTTCTACATTCCGCTGGTCTGTGTGCTTTTTAACTAACCTGAAAAGTTCAGCATGTATTGTCTTATTGGCAGGCTCCAGTTTCAGGGCCTTTCTTAGGATAGTGATAGCATCACTGTACTCCCCTTGCTGTGCCAACACCTTTCCTTTTCGGAACAGAGCCTTAATGTTTTCAGGCTGGTGCTCCAACACCATATTACAAGATTTCAGGGCAGCCTCATAATGGTCTAATTTCAGCTGTGATGCTGCAAGGTTGTTCAGACATTTCATTTTGACATCCAGTAAAGATGATTCTTCTTCTGAACTGAAATCAACTTTGGAGCTTGAATTCACTACATTTAGTGCTATGTCATAGGAAATTATAGCAAAAATATAGTCTGCTTGCTGGTAATAGAAATTGCCCCCGTCCCGTTTTTTGTTGGCCAAATTCAGCTTCTCCTGTCCAGAAGGTTCTCTAGATCTGGGTCATCGTGAACATCCAGCTGAGTAAGTTCATCGTTCATGTTGGGAAATGGGATGCTTCGCTAGGCTCTGGCGGTCGGTCCTTAGCAGNACTTGGCACTGAGGGAAAGAAGGAATGTTCAGCCTGCTGCAGCGAGCGAGCCCCAGGGGCNNGGGCCGGAAGGGAATTNGNGACACAGAGGGGGAAGGGGGAGGGNNGGTGANGNNNNNNNGAAAGTGNAGNGNGNGNGAGGNGGAGGAGGAGAGAANGAAANAGGGGGNCNAAANGGAGGGGGAANTGGGGGGAGGGNGNNNAANNNGANGGGGNGGGNTTGNNNNAAGGGNAAAAAGAGGGAGNGGGGNAGGGGGNNGGGNGGGCGGGTGGGGGGGGNGGAGAGGGGAGAAGAAGAAGGAAAGAAGAGGGGAGAGGGGNNGNNGGGNGNGGNAGGGGGNGNGGNGAGGGNNAGAAGGGAGGGGAAAGAAAGAGAAAAAAAAGANGAAAAAGAGAAAGAAATAAAAGGAGAGGGGGAGNNNNNAGNNNNNGGNNGGAANGGGGGGNGNNGGNGGGGGNGAANAGNNNAGGGNNNNAGAANAGAAGNGGNAAANN
Full Trace Sequence: GTGCCAGGGAAACAGCTTATGAACCATGTAATACGACTCACTACTAGGGGAGACCAGCCTGGAGGGCAAAAATGATCTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTACGAGCCGCTATTACGACAGACAGTGCAACACCTCCTATTGCCACAGCTGTTGCCCCAAAAAGCCACTTCCAAGGGATGGACCAAGAAGACTTGGAGGCAGGCTTTGCAGAAGCACTGCTTGGATTCCCCAGCATCTTTTTGTACATGGCACTTTCTACATTCCGCTGGTCTGTGTGCTTTTTAACTAACCTGAAAAGTTCAGCATGTATTGTCTTATTGGCAGGCTCCAGTTTCAGGGCCTTTCTTAGGATAGTGATAGCATCACTGTACTCCCCTTGCTGTGCCAACACCTTTCCTTTTCGGAACAGAGCCTTAATGTTTTCAGGCTGGTGCTCCAACACCATATTACAAGATTTCAGGGCAGCCTCATAATGGTCTAATTTCAGCTGTGATGCTGCAAGGTTGTTCAGACATTTCATTTTGACATCCAGTAAAGATGATTCTTCTTCTGAACTGAAATCAACTTTGGAGCTTGAATTCACTACATTTAGTGCTATGTCATAGGAAATTATAGCAAAAATATAGTCTGCTTGCTGGTAATAGAAATTGCCCCCGTCCCGTTTTTTGTTGGCCAAATTCAGCTTCTCCTGTCCAGAAGGTTCTCTAGATCTGGGTCATCGTGAACATCCAGCTGAGTAAGTTCATCGTTCATGTTGGGAAATGGGATGCTTCGCTAGGCTCTGGCGGTCGGTCCTTAGCAGNACTTGGCACTGAGGGAAAGAAGGAATGTTCAGCCTGCTGCAGCGAGCGAGCCCCAGGGGCNNGGGCCGGAAGGGAATTNGNGACACAGAGGGGGAAGGGGGAGGGNNGGTGANGNNNNNNNGAAAGTGNAGNGNGNGNGAGGNGGAGGAGGAGAGAANGAAANAGGGGGNCNAAANGGAGGGGGAANTGGGGGGAGGGNGNNNAANNNGANGGGGNGGGNTTGNNNNAAGGGNAAAAAGAGGGAGNGGGGNAGGGGGNNGGGNGGGCGGGTGGGGGGGGNGGAGAGGGGAGAAGAAGAAGGAAAGAAGAGGGGAGAGGGGNNGNNGGGNGNGGNAGGGGGNGNGGNGAGGGNNAGAAGGGAGGGGAAAGAAAGAGAAAAAAAAGANGAAAAAGAGAAAGAAATAAAAGGAGAGGGGGAGNNNNNAGNNNNNGGNNGGAANGGGGGGNGNNGGNGGGGGNGAANAGNNNAGGGNNNNAGAANAGAAGNGGNAAANN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTACGAGCCGCTATTACGA