ORFeome > flcn ORF1 – XORFeome v1.0

flcn ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: flcn
Gene ID: 1003595
Gene Page ID: 1003589
ORF Xenbase ID: 17275977

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124964
Original XGC clone length: 1740

Human orthology & disease relationships

NCBI Entrez ID: 201163
Ensembl gene IDs: ENSG00000154803,LRG_325
Directly associated (OMIM) disease MIM numbers: 114500,135150,144700,173600
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ837402
dbEST ID: 79655104
Trimmed Sequence: ATGAACGCCATTGTGGCACTCTGCCATTTCTGTGAGCTCCATGGACCCCGAACTTTGTTCTGCACAGAAGCTCTGCATTCCCCGCACCCCCAAGGGGCTAGTTGTGGAGACGGCATTGGCCAGGGAGAGCAAGCAGAGGATGAGGAGGTGGGAATTCAGATGAGCAGCAGGATCCGATGTCACAGTCCCGCAGAAGGGGCGAGTGCAGACTCCAACAGCCCCAGGCCTAAAAAGTCTGATATGTGTGAGGGTTGCCGTTCCTTAGCTGCGGGACATCCTGGGTACATCAGTCATGATAAGGAGACGTCCATTAAATATGTCAGCCACCAGCACCCTAACCACCCACAGCTGTTCAGCATTGTGCGCCAGGCCTGTGTGCGCAGCCTGAGTTGTGAGGTATGTCCTGGTAGAGAAGGTCCCATATTCTTTGGAGATGAGCAACACAGCTTTGTCTTTAGTCACACGTTTTTCATTAAAGACAGCCTGGCTCGGGGTTTCCAGAGGTGGTACAGCATCATTGTCATTATGATGGACAGAATCTACCTGATCAACTCCTGGCCCTTCCTGCTGGCTAAGATCAGAGGTGTCATTGATGAACTGCAAGGGAAAGGCGTAAAAGTGTTTTAAGCCGAGCAATTTTGGCTGTTCGCGGCGGCCCCCTGCCGAACAACACAAGCTTTCACACCCTTTCTGCACCCAGCGCAAAGGGAAATGGCACACCACTCTCCTAACCGCCTCTCCCAATTTAATGAATAACACACAAAAAAATCGCCTGCACCCCCCCCTTTTTCTTTTATCCTCTGAAAAGGGGTTGGG
Full Trace Sequence: GGGGGCCCCAATAATTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACGCCATTGTGGCACTCTGCCATTTCTGTGAGCTCCATGGACCCCGAACTTTGTTCTGCACAGAAGCTCTGCATTCCCCGCACCCCCAAGGGGCTAGTTGTGGAGACGGCATTGGCCAGGGAGAGCAAGCAGAGGATGAGGAGGTGGGAATTCAGATGAGCAGCAGGATCCGATGTCACAGTCCCGCAGAAGGGGCGAGTGCAGACTCCAACAGCCCCAGGCCTAAAAAGTCTGATATGTGTGAGGGTTGCCGTTCCTTAGCTGCGGGACATCCTGGGTACATCAGTCATGATAAGGAGACGTCCATTAAATATGTCAGCCACCAGCACCCTAACCACCCACAGCTGTTCAGCATTGTGCGCCAGGCCTGTGTGCGCAGCCTGAGTTGTGAGGTATGTCCTGGTAGAGAAGGTCCCATATTCTTTGGAGATGAGCAACACAGCTTTGTCTTTAGTCACACGTTTTTCATTAAAGACAGCCTGGCTCGGGGTTTCCAGAGGTGGTACAGCATCATTGTCATTATGATGGACAGAATCTACCTGATCAACTCCTGGCCCTTCCTGCTGGCTAAGATCAGAGGTGTCATTGATGAACTGCAAGGGAAAGGCGTAAAAGTGTTTTAAGCCGAGCAATTTTGGCTGTTCGCGGCGGCCCCCTGCCGAACAACACAAGCTTTCACACCCTTTCTGCACCCAGCGCAAAGGGAAATGGCACACCACTCTCCTAACCGCCTCTCCCAATTTAATGAATAACACACAAAAAAATCGCCTGCACCCCCCCCTTTTTCTTTTATCCTCTGAAAAGGGGTTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGCCATTGTGGCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ837401
dbEST ID: 79655103
Trimmed Sequence: GTTGCGACATTCAGAGGCAGTGGGGCTGCGCACACTGGACATGAGGTGAGATTTGTAGGTCTTGCTGAGACCGGTCATCCAGAATTTCAGCAGTTTTATATTGTCCTCTTCTGAAGCCCCAAGGATAACGAGAAGTTTCTGTGTATCCTCCTTGGGTCGGCTGTCAACTTTGGTGAACTTGAAGAGTACTTTCACTTTATTCATCCACTCCTCCTTCAGGCAGATTAGACACTGATCTACCACATCCATCGACAGATTCTCATTGCTCAGAGCAGCTTCTATCTTGTTTAGAATGATGAGTCCAACCTTGTCAGTGGCCACAGGGCTACCGCTTGCCACCAAAAATTCATATTTGCTCAGGGGCTCGTCATCCACAAAGAGGGCAGGGTAGAGGTTGGATCGATTCGCATGGCGGACATCGACCATGACAGCAAATTCAGATGACTGGACATGAAGGGGGATCTCTGCATGAGGGCTGAGCCCTAAGAAGTTGCAGCGATATGCATCCTCATATTTCACACTGTATGGAATGATCCGAACACAGNCCACAGGAAGCATGGCCTGCAAGACATCAAATGCAGACTGGATTAACTCTTGGTCTTGCCCTTTCCCGATGACTTGATTCCCCATAAGGACATGCCAGGCCAGCATGCCGGAAAGCAGGAACACCCAGGACCTGCCCTCAAGGTTTCTGAAAAAAATCTAAAGAAAACCCAT
Full Trace Sequence: GGGAAACCGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGCGACATTCAGAGGCAGTGGGGCTGCGCACACTGGACATGAGGTGAGATTTGTAGGTCTTGCTGAGACCGGTCATCCAGAATTTCAGCAGTTTTATATTGTCCTCTTCTGAAGCCCCAAGGATAACGAGAAGTTTCTGTGTATCCTCCTTGGGTCGGCTGTCAACTTTGGTGAACTTGAAGAGTACTTTCACTTTATTCATCCACTCCTCCTTCAGGCAGATTAGACACTGATCTACCACATCCATCGACAGATTCTCATTGCTCAGAGCAGCTTCTATCTTGTTTAGAATGATGAGTCCAACCTTGTCAGTGGCCACAGGGCTACCGCTTGCCACCAAAAATTCATATTTGCTCAGGGGCTCGTCATCCACAAAGAGGGCAGGGTAGAGGTTGGATCGATTCGCATGGCGGACATCGACCATGACAGCAAATTCAGATGACTGGACATGAAGGGGGATCTCTGCATGAGGGCTGAGCCCTAAGAAGTTGCAGCGATATGCATCCTCATATTTCACACTGTATGGAATGATCCGAACACAGNCCACAGGAAGCATGGCCTGCAAGACATCAAATGCAGACTGGATTAACTCTTGGTCTTGCCCTTTCCCGATGACTTGATTCCCCATAAGGACATGCCAGGCCAGCATGCCGGAAAGCAGGAACACCCAGGACCTGCCCTCAAGGTTTCTGAAAAAAATCTAAAGAAAACCCAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGCGACATTCAGAGGCAG