ORFeome > fli1 ORF1 – XORFeome v1.0

fli1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fli1
Gene ID: 5794051
Gene Page ID: 5794047
ORF Xenbase ID: 17275983

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC129781
Original XGC clone length: 867

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ838988
dbEST ID: 79656690
Trimmed Sequence: ATGCAGGGAGTTGACGGGAAGGAACTGTGTCGCATGACGCGGGAAGATTTCCTACGAATGGCCTCGTCGTACAGCACCGAAATGCTCATGTCACACTTGGCCTACCTGCGTCAGAACAGTCCAACATTCACCTACTCAGTAGTACCAGCTCTCCCCGCACACCAGCCAGCACCTCGTCATCCAGTGAAAACAGAGCCCCTGTATGAAGATGTGCGGAGACAAAGCTGGAGCTCGTCGGGGGGTTCAGTCCATAGAGTGTCTCCTCCGCTGACACCAGGAATCACAAGTACCACTAACACTGTGCGCAGCCCCCAAGATCCCTACCAGGTTTTGGGGCCGACGAGCAGTCGCCTCTCTAATCCGGGCAGTGGGCAGATTCAGTTGTGGCAGTTTCTATTGGAGCTCCTGTCTGACAGTTGCAATTCCAGCTGTATCGCGTGGGAAGGACTGAACGGGGAGTTCAAGATGACGGACCCCGATGAAGTCGCCCGGCGCTGGGGCGAGCGCAAGAGTAAACCCAACATGAACTACGACAAGCTGAGCCGGGCCCTGCGCTATTATTATGACAAGAACATCATGAGTAAAGTTCATGGGAAGAGATACGCCTACAGGTTTGACTTCCAGGGGATCCAGGTGGTGCAGCATTCGCATAACAACACCCCCCCAACCCCAAATACCCCCAAGGGAACTATAATTCACCCCAAGCCAAAGCCCCCGGCCCCCTACTTCCCATCACCCCTAATCTTCCCCCCTGATCCCCCGTCGTTTACTTCGCCTCCCCCCCCCACTGGGGGAAATTTTTCCCCGGCCCCGGCGCTTC
Full Trace Sequence: CGTGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGGGAGTTGACGGGAAGGAACTGTGTCGCATGACGCGGGAAGATTTCCTACGAATGGCCTCGTCGTACAGCACCGAAATGCTCATGTCACACTTGGCCTACCTGCGTCAGAACAGTCCAACATTCACCTACTCAGTAGTACCAGCTCTCCCCGCACACCAGCCAGCACCTCGTCATCCAGTGAAAACAGAGCCCCTGTATGAAGATGTGCGGAGACAAAGCTGGAGCTCGTCGGGGGGTTCAGTCCATAGAGTGTCTCCTCCGCTGACACCAGGAATCACAAGTACCACTAACACTGTGCGCAGCCCCCAAGATCCCTACCAGGTTTTGGGGCCGACGAGCAGTCGCCTCTCTAATCCGGGCAGTGGGCAGATTCAGTTGTGGCAGTTTCTATTGGAGCTCCTGTCTGACAGTTGCAATTCCAGCTGTATCGCGTGGGAAGGACTGAACGGGGAGTTCAAGATGACGGACCCCGATGAAGTCGCCCGGCGCTGGGGCGAGCGCAAGAGTAAACCCAACATGAACTACGACAAGCTGAGCCGGGCCCTGCGCTATTATTATGACAAGAACATCATGAGTAAAGTTCATGGGAAGAGATACGCCTACAGGTTTGACTTCCAGGGGATCCAGGTGGTGCAGCATTCGCATAACAACACCCCCCCAACCCCAAATACCCCCAAGGGAACTATAATTCACCCCAAGCCAAAGCCCCCGGCCCCCTACTTCCCATCACCCCTAATCTTCCCCCCTGATCCCCCGTCGTTTACTTCGCCTCCCCCCCCCACTGGGGGAAATTTTTCCCCGGCCCCGGCGCTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGGGAGTTGACGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838987
dbEST ID: 79656689
Trimmed Sequence: GTAGAAGGTCCCCAGGTGGGTCCCCAGTAGCCCCCCGTGTTGCCTCGTGATGCCCTGGCCGGGGTACAGTCCCCCAGTGGGTGCTGAGCTGAAGTACTGGACGGGGATCAGGGTGGAAGACTGAGGGTGATGGGAAGGTAAGGGCCCGGGGGCTTTGGCTTGGGGTGAATAATAGTTCCCTTCGGGGTATTTGGGGGTCGGGGGGTCGTTGTTATGCGAATGCTGCACCACCTGGATCCCCTGGAAGTCAAACCTGTAGGCGCATCTCTTCCCATGAACTTTACTCATGATGTTCTTGTCATAATAATATCGCATAGCCCGGCTCAGCTTGTCGTATTTCGTGTTGGGTTTACTCTTCCCCTCCCCCCAGCTCCAGGCGACTTCGTCGGGGTCCGTCATCTTGAACTCCCCTTTCCTTCCTTCCCACGCGATAGATGCAGGAGTTGGGGCGGGTGGGAAGGAAACTCCACTACAAACAGCCAAGACTGACTCTGCCCACTGCGCTGCATAAGTATACAACTGCGCGTCTGCCCTGAGACCCTCTACGGAGCTAGTGGATTGGGGGGGGTGTCGTTGGTAGCGGGGGTTTCGTGGGTGTCGCAGTGAGGAAAACTCTAATATATTCGACCTCCGGGAAGAAGCTCGAATAAGTTTCTCCCACTTCTTCCACATGCGGGCTCCTTCTTTGCCTTTTTTAGTAAAATTATCGGGATTGTACTGCCCGGGGAAGACCTGGGGGAGGGGAGTAAGCAACGGCGGAAAATTTAGAAACCA
Full Trace Sequence: AAACAGGCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGAAGGTCCCCAGGTGGGTCCCCAGTAGCCCCCCGTGTTGCCTCGTGATGCCCTGGCCGGGGTACAGTCCCCCAGTGGGTGCTGAGCTGAAGTACTGGACGGGGATCAGGGTGGAAGACTGAGGGTGATGGGAAGGTAAGGGCCCGGGGGCTTTGGCTTGGGGTGAATAATAGTTCCCTTCGGGGTATTTGGGGGTCGGGGGGTCGTTGTTATGCGAATGCTGCACCACCTGGATCCCCTGGAAGTCAAACCTGTAGGCGCATCTCTTCCCATGAACTTTACTCATGATGTTCTTGTCATAATAATATCGCATAGCCCGGCTCAGCTTGTCGTATTTCGTGTTGGGTTTACTCTTCCCCTCCCCCCAGCTCCAGGCGACTTCGTCGGGGTCCGTCATCTTGAACTCCCCTTTCCTTCCTTCCCACGCGATAGATGCAGGAGTTGGGGCGGGTGGGAAGGAAACTCCACTACAAACAGCCAAGACTGACTCTGCCCACTGCGCTGCATAAGTATACAACTGCGCGTCTGCCCTGAGACCCTCTACGGAGCTAGTGGATTGGGGGGGGTGTCGTTGGTAGCGGGGGTTTCGTGGGTGTCGCAGTGAGGAAAACTCTAATATATTCGACCTCCGGGAAGAAGCTCGAATAAGTTTCTCCCACTTCTTCCACATGCGGGCTCCTTCTTTGCCTTTTTTAGTAAAATTATCGGGATTGTACTGCCCGGGGAAGACCTGGGGGAGGGGAGTAAGCAACGGCGGAAAATTTAGAAACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGAAGGTCCCCAGGT