ORFeome > fmo5 ORF1 – XORFeome v1.0

fmo5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fmo5
Gene ID: 951238
Gene Page ID: 951232
ORF Xenbase ID: 17276055

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059977
Original XGC clone length: 1614

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ824475
dbEST ID: 79642177
Trimmed Sequence: ATGGTGAAAAAGATCTGTGTGGTTGGGGCAGGTTCCAGTGGTCTAGCGGCCATCAAATGCTGCTTAGAAGAGGACTTGGAGCCCACATGCTTTGAGAGATATCATGACATTGGGGGTCTATGGAGGTACAAGGAAGACCCTGAAGAAGGACGTGCTAGCATCTATAAATCTGTGATCATAAACACATCCAAGGAGATGATGTGCTTCAGTGATTATCCCATTCCAGATGACTTCCCCAACTACATGCACAACTCCAAAATCATGGACTATTTCCGCATGTATGCCAAGAACTTTAATTTGCTAAAATACATCCGCTTTAAGACAACAGTGTGTAGCATTAAGAAGCGACCTGACTTTGCTATCAGCGGCCAATGGGAAATTGTGACTGAGTGTGATGGAAAGCAGGACATGGGCATCTATGACGGAGTGCTACTGTGCAGTGGGCATCATACTTTCCCTAATCTTCCACTGGAATCCTTTCCAGGTATCGAGAAGTTTAAAGGCCAGTACTTCCATAGTCGGGAATACAAATACCCTCATTCATTCCAGGACAAGAGGATCATTGTCATTGGCATAGGAGATTCTGGAGGGGACTTGGCAGTAGAGCTAAGTACTGTTGCCCAACAGGTATACCTTAGCACCAGGAGAGGAGCGTGGGTCATCAATCGAGTCCATGATGAAAGCTACCCACTGGATGTCGTTCTATTGAGCCGATTAAAAACGTTATCAAGGAGTTCATGACTACTGACATGCTTGAATTGCTGGGGTTGAGAAAAGGCGTAAATGGCACGTTTTTAATTCATGAAA
Full Trace Sequence: CAAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAAAAAGATCTGTGTGGTTGGGGCAGGTTCCAGTGGTCTAGCGGCCATCAAATGCTGCTTAGAAGAGGACTTGGAGCCCACATGCTTTGAGAGATATCATGACATTGGGGGTCTATGGAGGTACAAGGAAGACCCTGAAGAAGGACGTGCTAGCATCTATAAATCTGTGATCATAAACACATCCAAGGAGATGATGTGCTTCAGTGATTATCCCATTCCAGATGACTTCCCCAACTACATGCACAACTCCAAAATCATGGACTATTTCCGCATGTATGCCAAGAACTTTAATTTGCTAAAATACATCCGCTTTAAGACAACAGTGTGTAGCATTAAGAAGCGACCTGACTTTGCTATCAGCGGCCAATGGGAAATTGTGACTGAGTGTGATGGAAAGCAGGACATGGGCATCTATGACGGAGTGCTACTGTGCAGTGGGCATCATACTTTCCCTAATCTTCCACTGGAATCCTTTCCAGGTATCGAGAAGTTTAAAGGCCAGTACTTCCATAGTCGGGAATACAAATACCCTCATTCATTCCAGGACAAGAGGATCATTGTCATTGGCATAGGAGATTCTGGAGGGGACTTGGCAGTAGAGCTAAGTACTGTTGCCCAACAGGTATACCTTAGCACCAGGAGAGGAGCGTGGGTCATCAATCGAGTCCATGATGAAAGCTACCCACTGGATGTCGTTCTATTGAGCCGATTAAAAACGTTATCAAGGAGTTCATGACTACTGACATGCTTGAATTGCTGGGGTTGAGAAAAGGCGTAAATGGCACGTTTTTAATTCATGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAAAAAGATCTGTGTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829829
dbEST ID: 79647531
Trimmed Sequence: AAGACAGATGAAGTAAACTGCAGCCAGGAGGGCAAAGACAGCCAGGAGTTTCAGAGGGAAAGGTATCACAGAATGGTGTTTTTTCATGTCATCATCAACCAGTACTCTGGACTTTGTGGGCTTAATAATGCGCTCTTGTTGGGTAAGGATTGCCTTCCTCGCTCCACTCCATTTGTTGGACCCCATCAGTCTATACTGATAGGGAGTGCAGGGCCCAAAGAACATCTCCCAGGCTAAAATTGGGTCAGTAAAGAGGAAGTGCAAAAGGTTTGGTTTCACTCCAAACTGGGAAGCCAATTCATCCATGTAATCCAAATAGTCAACTTGGATTGTGTGCCGAGGGCTCGTCACATATCGGCATTCCATTTCTTTCTTCTTGCAGGCTACATCTGCCAGCATGTCCTCCTGGGAAGGCAGTTTAGCCAGGCCTTTGAAAACACGCACTGCCCAGCGACATTGCAGCTCTGAGACAGGCATGATGGCCCCAAGGGGCTGAATAAGGCCTATACAAGCCACCGTTGTCTTCTCTAAATGTGGAGGGAAAACAAATTTGTACAATGGTATCTTGTTGTTTTCGGCGTTAAGAACGGAGTCTTNCAAGAAGGGAAAGGAAAAGCTGTACCCAGTGGCAAAAATACCACATCAATGTTTTTTTCTATCGTTCCATCTTCAAAAATGGCGTCAGTTTCTGTGAACCCCTTTCACTTTGGTCTTCATAATCCCTTTTGCAAAAAAATAAAAGCGGGTTTGGGGAGGGACTCCCCTTG
Full Trace Sequence: CCGTGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGACAGATGAAGTAAACTGCAGCCAGGAGGGCAAAGACAGCCAGGAGTTTCAGAGGGAAAGGTATCACAGAATGGTGTTTTTTCATGTCATCATCAACCAGTACTCTGGACTTTGTGGGCTTAATAATGCGCTCTTGTTGGGTAAGGATTGCCTTCCTCGCTCCACTCCATTTGTTGGACCCCATCAGTCTATACTGATAGGGAGTGCAGGGCCCAAAGAACATCTCCCAGGCTAAAATTGGGTCAGTAAAGAGGAAGTGCAAAAGGTTTGGTTTCACTCCAAACTGGGAAGCCAATTCATCCATGTAATCCAAATAGTCAACTTGGATTGTGTGCCGAGGGCTCGTCACATATCGGCATTCCATTTCTTTCTTCTTGCAGGCTACATCTGCCAGCATGTCCTCCTGGGAAGGCAGTTTAGCCAGGCCTTTGAAAACACGCACTGCCCAGCGACATTGCAGCTCTGAGACAGGCATGATGGCCCCAAGGGGCTGAATAAGGCCTATACAAGCCACCGTTGTCTTCTCTAAATGTGGAGGGAAAACAAATTTGTACAATGGTATCTTGTTGTTTTCGGCGTTAAGAACGGAGTCTTNCAAGAAGGGAAAGGAAAAGCTGTACCCAGTGGCAAAAATACCACATCAATGTTTTTTTCTATCGTTCCATCTTCAAAAATGGCGTCAGTTTCTGTGAACCCCTTTCACTTTGGTCTTCATAATCCCTTTTGCAAAAAAATAAAAGCGGGTTTGGGGAGGGACTCCCCTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGACAGATGAAGTAAACTGCAGC