ORFeome > fn3krp ORF1 – XORFeome v1.0

fn3krp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fn3krp
Gene ID: 6252785
Gene Page ID: 920683
ORF Xenbase ID: 17276079

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123221
Original XGC clone length: 999

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ838315
dbEST ID: 79656017
Trimmed Sequence: ATGGCTGCTCACAGGGATTCCGTTTTGTTGCCACAGAGGATGCTTCTGCTGAAGGCCGATGTTGTCGGACTCCTGGAGCTGGAAGAGCAATTAAGGAAAGTGCTGAAGACCTCCATCCTTTCCCTGGCCGGGCACAACCAGGGGGGCTTCATTAGCCAAGCACTGAGCTACGACACTGACCAGGGACGTGTGTTTGTAAAGATCAACTGCGGGGCACAGGCCAAAATAATGTTCACTGGCGAAGTAGCAAGTCTGAAGGGCATCAAGGAGACTGCCACAGTGCGTGTTCCGGAACCCATTGCTATGGCTGATCTACCAAGCGGAGGGGGGCTGCTGATTTTAGAGTATCTCCAGATGAGAAGCATAGGCAGGTTTGCTGAGAAACTGGGAGAGCAACTAGCCGACCTGCATCTGCACAACATATTGCTGAAGAGGAAGAGCCAGAGACAAAAGGGAACCATTGGTGAAAGGAACCAGGCAGTGGATAAGTTTGGCTTCCACACCATGACTTGCTGCGGGTATATCCCACAGGTGAACGACTGGCAAGATGACTGGGTGAACTTCTTTGCCCGTCAGAGATTGAAACCGCAGCTGGATCTTATTGAGAAAAACTACGGGGGACAGGGCAGTGCAGAGCCTCTGGACGGAGCTGCAGATAAAGCTGCCACAGGCATTTTAAGACACACTGATTATTCCATCTCTGCTTCCATGGGGAATTATGGGAAGCCCATGTACCTAAAGAACCAATCGGGGCCCCCTCCGGTTTCCACCCGGGGTTCTTTCAAGGGGCCCCCCCTTAAATTTAAATCTTTTCCCCA
Full Trace Sequence: GCCCCACAATAATAGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTCACAGGGATTCCGTTTTGTTGCCACAGAGGATGCTTCTGCTGAAGGCCGATGTTGTCGGACTCCTGGAGCTGGAAGAGCAATTAAGGAAAGTGCTGAAGACCTCCATCCTTTCCCTGGCCGGGCACAACCAGGGGGGCTTCATTAGCCAAGCACTGAGCTACGACACTGACCAGGGACGTGTGTTTGTAAAGATCAACTGCGGGGCACAGGCCAAAATAATGTTCACTGGCGAAGTAGCAAGTCTGAAGGGCATCAAGGAGACTGCCACAGTGCGTGTTCCGGAACCCATTGCTATGGCTGATCTACCAAGCGGAGGGGGGCTGCTGATTTTAGAGTATCTCCAGATGAGAAGCATAGGCAGGTTTGCTGAGAAACTGGGAGAGCAACTAGCCGACCTGCATCTGCACAACATATTGCTGAAGAGGAAGAGCCAGAGACAAAAGGGAACCATTGGTGAAAGGAACCAGGCAGTGGATAAGTTTGGCTTCCACACCATGACTTGCTGCGGGTATATCCCACAGGTGAACGACTGGCAAGATGACTGGGTGAACTTCTTTGCCCGTCAGAGATTGAAACCGCAGCTGGATCTTATTGAGAAAAACTACGGGGGACAGGGCAGTGCAGAGCCTCTGGACGGAGCTGCAGATAAAGCTGCCACAGGCATTTTAAGACACACTGATTATTCCATCTCTGCTTCCATGGGGAATTATGGGAAGCCCATGTACCTAAAGAACCAATCGGGGCCCCCTCCGGTTTCCACCCGGGGTTCTTTCAAGGGGCCCCCCCTTAAATTTAAATCTTTTCCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTCACAGGGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ838314
dbEST ID: 79656016
Trimmed Sequence: CAAACTATCCAAAATGGCCCTCATAAGGCTTAATGAACTGGCCTGGAAGTCAGACCCAAAGTGGTTCCAGTTGTTGAGGGAATGGAACAGCTGGTATAGCAGGGATCGGGTCTCGAACCCAGGAGCTTTGGGGATCTTCCTGTGATAGCTTGAGAAGAAAGCCATTCCCTGGGCTCCAAACATCTCCCCTATGGACAGATCATACTCAGAGTGGCCGTAGAAGGACCCCGGGTCGAACAGAAGGGGGCCCGACTCGTCCTCAGCTACATTGGCTTCCCATAAATCCCCATGGAGCAGAGATGGAATAATCAGTGTGTCTTTAAATGCCTTGTGCAGCTTTATCTGCAGCTCCGTCCAGAGGCTTTGCACTGCCCTGTCCCCGTAGTTTTTCTCAATAAGATCCAGCTGCGGTTTCAATCTCTGACGGGCAAAGAAGTTCACCCAGTCATCTTGCCAGTCGTTCACCTGTGGGATATACCCGCAGCAAGTCATGGTGTGGAAGCCAAACTTATCCACTGCCTGGTTCCTTTCACCATTGGTTCCCTTTTGTCTCTGGCTCTTCCTCTTCAGCAATATGTTGTGCAGATGCAGGTCGGCTAGTTGCTCCCCCAAGTTTCTCAGCAAACCCTGGCCAAGCCTTCTCATCCGGAAAATACTCTAAAATCCGCCAACCCCCCTCCCCCCTGGTAAAATCAACCAAAAACAATTGGGTTTTCGGGAAACACTCCACCTGTG
Full Trace Sequence: GGGAAAAAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAACTATCCAAAATGGCCCTCATAAGGCTTAATGAACTGGCCTGGAAGTCAGACCCAAAGTGGTTCCAGTTGTTGAGGGAATGGAACAGCTGGTATAGCAGGGATCGGGTCTCGAACCCAGGAGCTTTGGGGATCTTCCTGTGATAGCTTGAGAAGAAAGCCATTCCCTGGGCTCCAAACATCTCCCCTATGGACAGATCATACTCAGAGTGGCCGTAGAAGGACCCCGGGTCGAACAGAAGGGGGCCCGACTCGTCCTCAGCTACATTGGCTTCCCATAAATCCCCATGGAGCAGAGATGGAATAATCAGTGTGTCTTTAAATGCCTTGTGCAGCTTTATCTGCAGCTCCGTCCAGAGGCTTTGCACTGCCCTGTCCCCGTAGTTTTTCTCAATAAGATCCAGCTGCGGTTTCAATCTCTGACGGGCAAAGAAGTTCACCCAGTCATCTTGCCAGTCGTTCACCTGTGGGATATACCCGCAGCAAGTCATGGTGTGGAAGCCAAACTTATCCACTGCCTGGTTCCTTTCACCATTGGTTCCCTTTTGTCTCTGGCTCTTCCTCTTCAGCAATATGTTGTGCAGATGCAGGTCGGCTAGTTGCTCCCCCAAGTTTCTCAGCAAACCCTGGCCAAGCCTTCTCATCCGGAAAATACTCTAAAATCCGCCAACCCCCCTCCCCCCTGGTAAAATCAACCAAAAACAATTGGGTTTTCGGGAAACACTCCACCTGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAACTATCCAAAATGGCCCT