ORFeome > foxd1 ORF1 – XORFeome v1.0

foxd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: foxd1
Gene ID: 865762
Gene Page ID: 488076
ORF Xenbase ID: 17276163

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108577
Original XGC clone length: 1038

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ838000
dbEST ID: 79655702
Trimmed Sequence: ATGACTCTGAGCTCTGACATGTCCGATGTTCTTGCTGAAGAGACCGACATCGATGTGGTGGGAGAAGAGGACGAGCCGCGGGCAGAGGAAGAAGAGGAAGAGGATGGGGAGCTGCTGATGCCCCGCTCCCCGCACTGCTCCTCCACTAAAGACCCGTACAAGGCGGCGGGGTCGGGTGGGGTCGGCAGGAGCGCGTTGGTGAAGCCTCCCTACTCGTACATCGCGCTCATCACCATGTCCATCCTGCAGAGCCCCAAGAAGCGTCTGACCCTCAGCGAGATCTGCGACTTCATCAGCAGCCGCTTCCCCTACTACCGGGAGAAGTTCCCCGCCTGGCAGAACTCCATCCGCCACAACCTGTCCCTCAACGACTGCTTCGTCAAGATCCCCCGGGAGCCCGGAAACCCCGGCAAGGGCGACTACTGGACGCTGGACCCGGAGTCGGCCGACATGTTTGACAACGGCAGTTTCCTGCGGAGAAGAAAGCGCTTTAAGAGACAGCAAGTCCCGGAGCTTGTGGTTAGGGAGCCCGGACACTTTCTGCCGGCCTCTGCCTATGGCTATGGACCTTACAGCTGTGCCTATGGCATCCGAATCCAGCCTTCCCACCTCACTCTGCCCTGAGCGGCCTGCCAGCGCAACCAGCAGGCCCAGCAGCAACAAGCCCGGCTTCGCGGGCAACCAGTTCGGCACCCGCGGGAAAAAGCCGAACAGTTAACAACAACCCCCCCAGCCCCCCCTTCCAGGGGTGGGGGGGGGGGGGCGGGCCGCCCGGCGTGCCCGGGGGTTGCGGTGGAGGAACGGGGCGGGTT
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCTGAGCTCTGACATGTCCGATGTTCTTGCTGAAGAGACCGACATCGATGTGGTGGGAGAAGAGGACGAGCCGCGGGCAGAGGAAGAAGAGGAAGAGGATGGGGAGCTGCTGATGCCCCGCTCCCCGCACTGCTCCTCCACTAAAGACCCGTACAAGGCGGCGGGGTCGGGTGGGGTCGGCAGGAGCGCGTTGGTGAAGCCTCCCTACTCGTACATCGCGCTCATCACCATGTCCATCCTGCAGAGCCCCAAGAAGCGTCTGACCCTCAGCGAGATCTGCGACTTCATCAGCAGCCGCTTCCCCTACTACCGGGAGAAGTTCCCCGCCTGGCAGAACTCCATCCGCCACAACCTGTCCCTCAACGACTGCTTCGTCAAGATCCCCCGGGAGCCCGGAAACCCCGGCAAGGGCGACTACTGGACGCTGGACCCGGAGTCGGCCGACATGTTTGACAACGGCAGTTTCCTGCGGAGAAGAAAGCGCTTTAAGAGACAGCAAGTCCCGGAGCTTGTGGTTAGGGAGCCCGGACACTTTCTGCCGGCCTCTGCCTATGGCTATGGACCTTACAGCTGTGCCTATGGCATCCGAATCCAGCCTTCCCACCTCACTCTGCCCTGAGCGGCCTGCCAGCGCAACCAGCAGGCCCAGCAGCAACAAGCCCGGCTTCGCGGGCAACCAGTTCGGCACCCGCGGGAAAAAGCCGAACAGTTAACAACAACCCCCCCAGCCCCCCCTTCCAGGGGTGGGGGGGGGGGGGCGGGCCGCCCGGCGTGCCCGGGGGTTGCGGTGGAGGAACGGGGCGGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGAGCTCTGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837999
dbEST ID: 79655701
Trimmed Sequence: GTGGTTTGTAAGCACCGTCCCAGGCTGCAGGTTTCCCCCTAAAGCAGCAGCAGCCTCTGAGCTGGAGAAAGTCACCAGGGCCCTAGAGATCACAGGGACCCCAGCTGCTTTGGGGCCAGGGTTGAGGTCCCCCCCTATGATACTCTCAATGGAAAAGGTGGATCTGGCAAGGGCTGAGCTGGATTTGCTCTGCAGGGAGGGCGGCAGGGCTGCTGGGCTGAGCTGGTGAGGGTAGAAAGTGCAGGTCCTTGATAGATCCTGGGCAGCAGGAGGCATGAGGGCTGGGGCAGCCATGGAAGGGAGGCTGGGGGGCTGCTGCTGATGTCTGGCTTGTTGCTGCTGGTGCCGGACTTGTTGCTGCTGATGCCGGGCTTGTTGCTGCTGGTGCTGCTGCTGCTGCTGGGAAGGCGATCAAAGCAGAGTGTGGGTGGGAAAACTGAATCTGTATTAACATAACACAGCTCTAAGGTGCGGAGCCATAGGCAAAGGCAAACATAAAGGGGGCGGGCGTCGGAAGCACAAACACAAGAGGTGGTGGCTCTGGAGAGCACTATCTTCTCTCCAGAAACTACCTTTATCAGAAATTTCCTACCGACTCCAAGTCCAACCTCGAGAAATAGGCCGTTGCCGGGGGTTTCTTGCTTCCGGGGGGGGGGTACACGAGGGAAGACAAGGAAAGAACAATGGTCGGGGCGGGGGGGGGGGGGGTGGGGGTGCGCACCAGACCTCCGCGCCCGGGGGGTGAGGGAAAAAAGTGGAACAGGGGGG
Full Trace Sequence: AAAAGGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGTTTGTAAGCACCGTCCCAGGCTGCAGGTTTCCCCCTAAAGCAGCAGCAGCCTCTGAGCTGGAGAAAGTCACCAGGGCCCTAGAGATCACAGGGACCCCAGCTGCTTTGGGGCCAGGGTTGAGGTCCCCCCCTATGATACTCTCAATGGAAAAGGTGGATCTGGCAAGGGCTGAGCTGGATTTGCTCTGCAGGGAGGGCGGCAGGGCTGCTGGGCTGAGCTGGTGAGGGTAGAAAGTGCAGGTCCTTGATAGATCCTGGGCAGCAGGAGGCATGAGGGCTGGGGCAGCCATGGAAGGGAGGCTGGGGGGCTGCTGCTGATGTCTGGCTTGTTGCTGCTGGTGCCGGACTTGTTGCTGCTGATGCCGGGCTTGTTGCTGCTGGTGCTGCTGCTGCTGCTGGGAAGGCGATCAAAGCAGAGTGTGGGTGGGAAAACTGAATCTGTATTAACATAACACAGCTCTAAGGTGCGGAGCCATAGGCAAAGGCAAACATAAAGGGGGCGGGCGTCGGAAGCACAAACACAAGAGGTGGTGGCTCTGGAGAGCACTATCTTCTCTCCAGAAACTACCTTTATCAGAAATTTCCTACCGACTCCAAGTCCAACCTCGAGAAATAGGCCGTTGCCGGGGGTTTCTTGCTTCCGGGGGGGGGGTACACGAGGGAAGACAAGGAAAGAACAATGGTCGGGGCGGGGGGGGGGGGGGTGGGGGTGCGCACCAGACCTCCGCGCCCGGGGGGTGAGGGAAAAAAGTGGAACAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGTTTGTAAGCACCGTC