ORFeome > foxi4.2 ORF2 – XORFeome v1.0

foxi4.2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: foxi4.2
Gene ID: 865722
Gene Page ID: 487657
ORF Xenbase ID: 17276205

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC080044
Original XGC clone length: 1023

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11047
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ831178
dbEST ID: 79648880
Trimmed Sequence: ATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACAGCCCTACCCCTGCCCCTTACATACCCCCTGCCTTCAGCGCCCCCCAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGANAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCCAAAGGCAAAAAAAGCCCACCCATGGATACTCCCTCCTCCCCCAAGGAGCTGTCTCCCACAGGCCATAACAAGTGGCCATTCTCCCCCAACTGTCCCCCTACACCCCCCTGTCTCAAACCAAACTTCATTTGGGCAACCTGGAACTGCCCGTGGGAAATTCACCC
Full Trace Sequence: GACGTCTTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACAGCCCTACCCCTGCCCCTTACATACCCCCTGCCTTCAGCGCCCCCCAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGANAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCCAAAGGCAAAAAAAGCCCACCCATGGATACTCCCTCCTCCCCCAAGGAGCTGTCTCCCACAGGCCATAACAAGTGGCCATTCTCCCCCAACTGTCCCCCTACACCCCCCTGTCTCAAACCAAACTTCATTTGGGCAACCTGGAACTGCCCGTGGGAAATTCACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACTTTATTGTGACAACTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ831179
dbEST ID: 79648881
Trimmed Sequence: GTACCTTCCCTGGTACAGAGGAGACTGCTGGGGATGGAGCTGCTGAAGGTACGGTGGCTGCTTCTGGTTAGAGGTGGGCAAGGAGCTGTAGTAGGGGCTTCTGTTATAGAACAGGCTACTGTCCTGATGCTCAGGGCTCTGATCAACTGCGGAGCCCGAGATGAAGCTGCTCAAGCCATTGAGGTTCCTCTGAGATAATTCATTGAGAAGCCCCAGGGGGCCCTGTCTGTTCATTGTAGCTGAGTCCACGGCAGTCATGCTGCCAATGAAGTTGGTTAGACAGGGGGTGTAGGTGACAGTTGGGGGAGATGGGCACTTGCTATGGCCTGTGGGAGACAGCTCCTTGGGGGAGGAGGGAGTAATCATGGGTGGGCTTTCTTTGCCTTTTGGGCTCACGTGATCCTCTTCCCTCTTAGCGATTTTAATGTTGTTGGTCTCAGATTTGGGCTTTCTCTTCCGGCGGAAATTACCATTGTCAAACATCTTCTCGCAGTTGGAGTCCAGAGTCCAGTAGTTTCCTTTTCCTGGATCATTCTCATCCCTTGGCATCTTCTTGAAGCAGTCATTGAGGGACAGGTTGTGCCTGATGGAGTTCTGCCAGCCTGCTTTGCACTTCTTGTANGAGAGGGAAGTTTCTGCCACATACTGGTAGATCTGGCCTCAGGGTGAGTTCTCTTGGCCGGTCGCAATCTGGGAATGGAACATACCGAATTAAGGGCAGAAATAACAAATTAAAGGGGGGGCCCCCAC
Full Trace Sequence: CTTGCGGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTACCTTCCCTGGTACAGAGGAGACTGCTGGGGATGGAGCTGCTGAAGGTACGGTGGCTGCTTCTGGTTAGAGGTGGGCAAGGAGCTGTAGTAGGGGCTTCTGTTATAGAACAGGCTACTGTCCTGATGCTCAGGGCTCTGATCAACTGCGGAGCCCGAGATGAAGCTGCTCAAGCCATTGAGGTTCCTCTGAGATAATTCATTGAGAAGCCCCAGGGGGCCCTGTCTGTTCATTGTAGCTGAGTCCACGGCAGTCATGCTGCCAATGAAGTTGGTTAGACAGGGGGTGTAGGTGACAGTTGGGGGAGATGGGCACTTGCTATGGCCTGTGGGAGACAGCTCCTTGGGGGAGGAGGGAGTAATCATGGGTGGGCTTTCTTTGCCTTTTGGGCTCACGTGATCCTCTTCCCTCTTAGCGATTTTAATGTTGTTGGTCTCAGATTTGGGCTTTCTCTTCCGGCGGAAATTACCATTGTCAAACATCTTCTCGCAGTTGGAGTCCAGAGTCCAGTAGTTTCCTTTTCCTGGATCATTCTCATCCCTTGGCATCTTCTTGAAGCAGTCATTGAGGGACAGGTTGTGCCTGATGGAGTTCTGCCAGCCTGCTTTGCACTTCTTGTANGAGAGGGAAGTTTCTGCCACATACTGGTAGATCTGGCCTCAGGGTGAGTTCTCTTGGCCGGTCGCAATCTGGGAATGGAACATACCGAATTAAGGGCAGAAATAACAAATTAAAGGGGGGGCCCCCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACCTTCCCTGGTACAGA