ORFeome > foxp4 ORF1 – XORFeome v1.0

foxp4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: foxp4
Gene ID: 982697
Gene Page ID: 982691
ORF Xenbase ID: 17276235

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124940
Original XGC clone length: 1926

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ837447
dbEST ID: 79655149
Trimmed Sequence: ATGATGGTAGAATCTGAGTCCATACGGTCCACCCCAACCAGCCAAAATGGAGTTGGAAGTCTCCCTAACCAATCTGACAGTTGTGTTGGAAGAGAAGGATCAGGCAGTGGAGAGACCAATGGAGAGCTAAACCCAGCTGAACTTCTTCATTTTCAGCAACAACAGGCTCTGCAGATGGCAAGGCAACTTCTTCTTCAGCAAGCAACAGGTTTGAACTCCCATAGCACAGATAACAAGCAGCCCTCAGTACAGGTCCCAGTTTCCGTTGCTATGATGTCCCCTCAGATGATCACCCCCCAGCAGATGCAGCAGATTCTGTCCCCAGCACAGCTCCAGGCTGTCTTACAGCAGCAGCAGGCACTCATGCTACAACAGTTGCAGGAGTATTACAAGAAACAACAGGAACAGCTGCACCTTCAGCTTCTCTCTCAACAACAGGCAGGGAAGCAGCAACCCAAAGAGTTAGCTTTGGGAAACAAGCAATTGGCATTCCAGCAGCAACTGTTACAAATGCAACAACTGCAGCAACAGCACTTAATAAACCTCCAGAGGCAGAACCTGGTGGGACTCCAGTCTGGGCAAGGGCCAGTACCAATGCAGAGTCTACCACAAGTATCCCCATCAAACCTGCATCAGCTCTTAAAGGAGATGAGCAGCAGTCAAGAAGAATCCAGTAAACAGGAAACTGGTTGACCTGAATAACTCAATCACTACCCTCATTCCCAACTACCAAGGTTTTACCCTCCCAACAATTGGACCCCCTCCTTAACCTAAAGGGGCAAAAAAAACACGCACAAAAAAAAACCAATTC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGGTAGAATCTGAGTCCATACGGTCCACCCCAACCAGCCAAAATGGAGTTGGAAGTCTCCCTAACCAATCTGACAGTTGTGTTGGAAGAGAAGGATCAGGCAGTGGAGAGACCAATGGAGAGCTAAACCCAGCTGAACTTCTTCATTTTCAGCAACAACAGGCTCTGCAGATGGCAAGGCAACTTCTTCTTCAGCAAGCAACAGGTTTGAACTCCCATAGCACAGATAACAAGCAGCCCTCAGTACAGGTCCCAGTTTCCGTTGCTATGATGTCCCCTCAGATGATCACCCCCCAGCAGATGCAGCAGATTCTGTCCCCAGCACAGCTCCAGGCTGTCTTACAGCAGCAGCAGGCACTCATGCTACAACAGTTGCAGGAGTATTACAAGAAACAACAGGAACAGCTGCACCTTCAGCTTCTCTCTCAACAACAGGCAGGGAAGCAGCAACCCAAAGAGTTAGCTTTGGGAAACAAGCAATTGGCATTCCAGCAGCAACTGTTACAAATGCAACAACTGCAGCAACAGCACTTAATAAACCTCCAGAGGCAGAACCTGGTGGGACTCCAGTCTGGGCAAGGGCCAGTACCAATGCAGAGTCTACCACAAGTATCCCCATCAAACCTGCATCAGCTCTTAAAGGAGATGAGCAGCAGTCAAGAAGAATCCAGTAAACAGGAAACTGGTTGACCTGAATAACTCAATCACTACCCTCATTCCCAACTACCAAGGTTTTACCCTCCCAACAATTGGACCCCCTCCTTAACCTAAAGGGGCAAAAAAAACACGCACAAAAAAAAACCAATTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGTAGAATCTGAGTCCATA

Sequences - 3ʹ (reverse) EST

Accession: JZ837446
dbEST ID: 79655148
Trimmed Sequence: AGGCAAGTCTTCCATGGGCGACTCTGACTCTAGGTCACGATCTTCTGGCAGGACTGTAGTTTGGTTAGTAGGTGCAGAAATAGAGGCAGGTCTGACATCATCTTCTGCTGGCTCCTCCTTGACATGGATGGACTGACTATACTGAGGAGACAGACGAGGGCTGCTTCCATTGATGTTTCCAGATTCCCCAGTGCTGGTTACATCATCATGCCCACCATGGAGGACACTGCCTGAACTGTTGTGCAGTGGTGGGCTGTTGAGAAGTGGGAAGCTACTTTCTGCAAGGGCAGCCTGGTAACTTGCATTCAGGGCACTGTATCCCACCCCCGATATCATGTTTTTAACAAAGGTCGGGCTACCAGTCATCTTTGGTGGTCTTCTCTTTTACTATTGCAACTCATCTACCCTCCACACAGCACCCTTCGCAGTCTCCACACTTGCAATGCACTTATGCTTGGGCAAGTTAGTGACGAACTGCATTCTTCCCACTACCAATGTTCCTGGGAAACTATGGGGAGCGGCATCTGGACCGGGTGAAGGGTCTCATATAATGTAACTCTGCCTGACTAGTCCTCCTGGGGTACACGGAGCCAACTGATGAAGGAAATGGGGCAGCCAGGGAAGGGCGTGCAGCATTCATAAGAACAGTTTGGATTGGGGATGATTTTGTAAAAAAGAGCCATCGTGAGAGGGGGGGGGGGGGCAGATCAGCAAACCAGCGCACTCTCTCTCTACACAGAGGGGGCAAAAAAGAGAGGGGGGGGGGGGAGAGCATGGATAC
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGCAAGTCTTCCATGGGCGACTCTGACTCTAGGTCACGATCTTCTGGCAGGACTGTAGTTTGGTTAGTAGGTGCAGAAATAGAGGCAGGTCTGACATCATCTTCTGCTGGCTCCTCCTTGACATGGATGGACTGACTATACTGAGGAGACAGACGAGGGCTGCTTCCATTGATGTTTCCAGATTCCCCAGTGCTGGTTACATCATCATGCCCACCATGGAGGACACTGCCTGAACTGTTGTGCAGTGGTGGGCTGTTGAGAAGTGGGAAGCTACTTTCTGCAAGGGCAGCCTGGTAACTTGCATTCAGGGCACTGTATCCCACCCCCGATATCATGTTTTTAACAAAGGTCGGGCTACCAGTCATCTTTGGTGGTCTTCTCTTTTACTATTGCAACTCATCTACCCTCCACACAGCACCCTTCGCAGTCTCCACACTTGCAATGCACTTATGCTTGGGCAAGTTAGTGACGAACTGCATTCTTCCCACTACCAATGTTCCTGGGAAACTATGGGGAGCGGCATCTGGACCGGGTGAAGGGTCTCATATAATGTAACTCTGCCTGACTAGTCCTCCTGGGGTACACGGAGCCAACTGATGAAGGAAATGGGGCAGCCAGGGAAGGGCGTGCAGCATTCATAAGAACAGTTTGGATTGGGGATGATTTTGTAAAAAAGAGCCATCGTGAGAGGGGGGGGGGGGGCAGATCAGCAAACCAGCGCACTCTCTCTCTACACAGAGGGGGCAAAAAAGAGAGGGGGGGGGGGGAGAGCATGGATAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGCAAGTCTTCCATGGGCGA