ORFeome > fstl3 ORF1 – XORFeome v1.0

fstl3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fstl3
Gene ID: 876432
Gene Page ID: 876425
ORF Xenbase ID: 17276319

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123193
Original XGC clone length: 768

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ838343
dbEST ID: 79656045
Trimmed Sequence: ATGCTGCAATTCCTGCTGCTCCCTCTTCTGCTCTGCACTGTTACCCGGGGCCACCCAATTCCAGGAGGTGACACACTGCAGTCTGGTGGTACATGCTGGCTGCTCCAGGGTACAGATTCCACATGCAGTAGGATGCTGCTTAGCTCAGTGACATGGGATGAATGCTGTAGGGATGGGCACCTAGATACAGCATGGTCCAACTACACTGAACCAATAAATAAGATCAGTCTTCTGGGCTTCCTGGGTCTGGTCACTTGCCAGCCCTGCAGAGACAGTTGTGAAGGGGTGCAGTGTCCCCCTGGGAAGACATGTTTCCTAAAAGACGGGCGCCCACAGTGTGAATGCACACCAGATTGCTCAGGTCTGGATGTCGATGTGCCAGTTTGTGGCTCTGATGGCCACACATACAAGGATGAGTGTGAACTGATCACCAAGAAATGTCAGGGCCATCCAGATCTGGAGATCATGTACTATGGGAAGTGCAAAAAGTCCTGCTCTAATGTAGTTTGCCCAGGCACTCATTCTTGTGTGGTGGATCAAACAGGGAGTGCCCACTGTGTTGTTTGCCGCTCAACGCCTTGTCCACCGCCATTTGCTTCTGAAAACATGCTGTGTTGGAACAATAATGTCACTTATCCTTCTTCATGTCATCTTCGCAGAGCCCCCTGCTATCTAGGAAAGTCTATTTGGGGTTCGTCACCACAGGCAGTTTTTCCGAATATTCCCTAAATTTTCCATTGAATCTTGAATAAAAATTGTAAAAAAATTAATTTCCTTGCCCAACCTTTTTTTGGTACACAAATTTGGCCCTTTTAAAA
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGCAATTCCTGCTGCTCCCTCTTCTGCTCTGCACTGTTACCCGGGGCCACCCAATTCCAGGAGGTGACACACTGCAGTCTGGTGGTACATGCTGGCTGCTCCAGGGTACAGATTCCACATGCAGTAGGATGCTGCTTAGCTCAGTGACATGGGATGAATGCTGTAGGGATGGGCACCTAGATACAGCATGGTCCAACTACACTGAACCAATAAATAAGATCAGTCTTCTGGGCTTCCTGGGTCTGGTCACTTGCCAGCCCTGCAGAGACAGTTGTGAAGGGGTGCAGTGTCCCCCTGGGAAGACATGTTTCCTAAAAGACGGGCGCCCACAGTGTGAATGCACACCAGATTGCTCAGGTCTGGATGTCGATGTGCCAGTTTGTGGCTCTGATGGCCACACATACAAGGATGAGTGTGAACTGATCACCAAGAAATGTCAGGGCCATCCAGATCTGGAGATCATGTACTATGGGAAGTGCAAAAAGTCCTGCTCTAATGTAGTTTGCCCAGGCACTCATTCTTGTGTGGTGGATCAAACAGGGAGTGCCCACTGTGTTGTTTGCCGCTCAACGCCTTGTCCACCGCCATTTGCTTCTGAAAACATGCTGTGTTGGAACAATAATGTCACTTATCCTTCTTCATGTCATCTTCGCAGAGCCCCCTGCTATCTAGGAAAGTCTATTTGGGGTTCGTCACCACAGGCAGTTTTTCCGAATATTCCCTAAATTTTCCATTGAATCTTGAATAAAAATTGTAAAAAAATTAATTTCCTTGCCCAACCTTTTTTTGGTACACAAATTTGGCCCTTTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCAATTCCTGCTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838342
dbEST ID: 79656044
Trimmed Sequence: GACATAATTCTTCACACTGTCATCCAGATCCATGGAAAATTCAGGGATATCTGCACAACTGCCTGTGTGACGAACCCCAATAGACCTTCCTAGATAGCAGGTGGCTCTGCGAAGATGACATGCAGAAGGATAAGTGACATTATTGTTCCCACACAGCATGTTTTCAGAAGCAAATGGCGGTGGACAAGGCGTTGAGCGGCAAACAACACAGTGGGCACTCCCTGTTTGATCCACCACACAAGAATGAGTGCCTGGGCAAACTACATTAGAGCAGGACTTTTTGCACTTCCCATAGTACATGATCTCCAGATCTGGATGGCCCTGACATTTCTTGGTGATCAGTTCACACTCATCCTTGTATGTGTGGCCATCAAAGCCACAAACTGGCACATCGACATCCAGACCTGAGCAATCTGGTGTGCATTCACACTGTGGGCGCCCGTCTTTTAGGAAACATGTCTTCCCAGGGGGACACTGCACCCCTTCACAACTGTCTCTGCAGGGCTGGCAAGTGACCAGACCCAGGAAGCCCAGAAGACTGATCTTATTTATTGGTTCAGTGTAGTTGGACCATGCTGTATCTAGGTGCCCATCCCTAAGCCATCATCCCATGTCACTGAGCTAAGCAGCATCCAACTGCATGGTGAATCTGTACCCTGGAACAGCCAGCATGTACCACCCAACCGCCATTGGTTCACCTCCCTGGAAATTGGGGTGGCCCCCGGGTAACAGGTGCACAAACAAAAAAAAGGGAAGCAA
Full Trace Sequence: GGGAAACTGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACATAATTCTTCACACTGTCATCCAGATCCATGGAAAATTCAGGGATATCTGCACAACTGCCTGTGTGACGAACCCCAATAGACCTTCCTAGATAGCAGGTGGCTCTGCGAAGATGACATGCAGAAGGATAAGTGACATTATTGTTCCCACACAGCATGTTTTCAGAAGCAAATGGCGGTGGACAAGGCGTTGAGCGGCAAACAACACAGTGGGCACTCCCTGTTTGATCCACCACACAAGAATGAGTGCCTGGGCAAACTACATTAGAGCAGGACTTTTTGCACTTCCCATAGTACATGATCTCCAGATCTGGATGGCCCTGACATTTCTTGGTGATCAGTTCACACTCATCCTTGTATGTGTGGCCATCAAAGCCACAAACTGGCACATCGACATCCAGACCTGAGCAATCTGGTGTGCATTCACACTGTGGGCGCCCGTCTTTTAGGAAACATGTCTTCCCAGGGGGACACTGCACCCCTTCACAACTGTCTCTGCAGGGCTGGCAAGTGACCAGACCCAGGAAGCCCAGAAGACTGATCTTATTTATTGGTTCAGTGTAGTTGGACCATGCTGTATCTAGGTGCCCATCCCTAAGCCATCATCCCATGTCACTGAGCTAAGCAGCATCCAACTGCATGGTGAATCTGTACCCTGGAACAGCCAGCATGTACCACCCAACCGCCATTGGTTCACCTCCCTGGAAATTGGGGTGGCCCCCGGGTAACAGGTGCACAAACAAAAAAAAGGGAAGCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACATAATTCTTCACACTGTCATC