ORFeome > ftcd ORF1 – XORFeome v1.0

ftcd ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ftcd
Gene ID: 963751
Gene Page ID: 963744
ORF Xenbase ID: 17276325

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC054248
Original XGC clone length: 1410

Human orthology & disease relationships

NCBI Entrez ID: 10841
Ensembl gene IDs: ENSG00000160282
Directly associated (OMIM) disease MIM numbers: 229100
Indirectly associated (Lage, et al.) disease MIM numbers: 229100,236250,250940,259900,600794,601472,605899,606664,608688

Library Location

Plate ID: GDExl11003
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ839523
dbEST ID: 79657225
Trimmed Sequence: ATGATTGATATGCGCAACCACAAAGGTGAGCACCCACGTATGGGAGCACTGGATGTGTGTCCATTTATCCCTGTCAGAAATGTCACAATGGAAGAGTGTGTGGCCTGTGCCAACCAGTTTGCTAAGCGACTGGCAAAGGAGCTACAAGTTCCAGTGTATCTGTATGGTGAAGCTGCTCGCAGTGAAAGCCGCAGATCCCTGCCAGCTGTACGGGCTGGAGAATATGAAGCTTTGCCCACTAAGCTGAAGAACCCAGAATGGGCTCCTGACTTTGGTGAGCCAGTCTTTGTCCCTAGCTGGGGTGCAACTGTGAGTGGAGCTCGCAAGTTCCTAATTGCTTACAACATCAATTTATTGAGCACCAAAGAGTTGGCTCATCGCATTGCTCTTAATATTCGTGAGGGTGGCCGTGGAAAGGATCAGCCAGGGCGTCTTCAGAAGATCCAGGCAATTGGATGGTTCCTTCAGGAAGAAAATTTGGCACAAGTCTCAACAAATCTACTTGATTTTGAAATAACCCCTCTGCATGTAGTATATGAAGAGGTGTGCAAGGATGCCAAGGAACTGACCCTCCCTGTAATAGGTTCCCAGTTTGGTGGGTTTGGTGCCCCTCCAGTCTCTGCTAGATTCTGCAGAGTTTTATATCCAGAAAGAGAAACTGTTTGTACTTGAGGAGGAGCACAAAATCAGACTGGTAAATAACCCGTCTTTGGTCTGGACTCCTTTGGCGCCATTTGAATCTTCGACAAAAAAATTATCGAAGTACCTTTGGTCAAGGAATGAATCTTTTCCGAAAGGC
Full Trace Sequence: TCGGGGCCCAAATAATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTGATATGCGCAACCACAAAGGTGAGCACCCACGTATGGGAGCACTGGATGTGTGTCCATTTATCCCTGTCAGAAATGTCACAATGGAAGAGTGTGTGGCCTGTGCCAACCAGTTTGCTAAGCGACTGGCAAAGGAGCTACAAGTTCCAGTGTATCTGTATGGTGAAGCTGCTCGCAGTGAAAGCCGCAGATCCCTGCCAGCTGTACGGGCTGGAGAATATGAAGCTTTGCCCACTAAGCTGAAGAACCCAGAATGGGCTCCTGACTTTGGTGAGCCAGTCTTTGTCCCTAGCTGGGGTGCAACTGTGAGTGGAGCTCGCAAGTTCCTAATTGCTTACAACATCAATTTATTGAGCACCAAAGAGTTGGCTCATCGCATTGCTCTTAATATTCGTGAGGGTGGCCGTGGAAAGGATCAGCCAGGGCGTCTTCAGAAGATCCAGGCAATTGGATGGTTCCTTCAGGAAGAAAATTTGGCACAAGTCTCAACAAATCTACTTGATTTTGAAATAACCCCTCTGCATGTAGTATATGAAGAGGTGTGCAAGGATGCCAAGGAACTGACCCTCCCTGTAATAGGTTCCCAGTTTGGTGGGTTTGGTGCCCCTCCAGTCTCTGCTAGATTCTGCAGAGTTTTATATCCAGAAAGAGAAACTGTTTGTACTTGAGGAGGAGCACAAAATCAGACTGGTAAATAACCCGTCTTTGGTCTGGACTCCTTTGGCGCCATTTGAATCTTCGACAAAAAAATTATCGAAGTACCTTTGGTCAAGGAATGAATCTTTTCCGAAAGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTGATATGCGCAACCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839522
dbEST ID: 79657224
Trimmed Sequence: GTTTCTTCCATCACACACTTGGAGCACAGACAGCGCACTTGTTTTTGCCTCATCCAACAGCCTGGAAACTTTCTCTTCAGTCTGACTTTTGAATTCAATATCCTTTATCTCCCGCAGATTGATTAGGACATTAAAGTAAGCCCCAAATACTCCAGTTTCTAATGCTTTGGCGGCTACCTGCAAATCAGATTTGCATGCAATGTTTCCATGTTTTGACATTTCCAGCAGAGGGTGCCACAAGGTATTGATGTGCTCTGCCAGAGTGAGTGGCACTTTAACAGCTTCCTTTAGGCCCTCCTGTAGGGCAGCAGAACGCTTCTCTTGCTCTTCAGCTGTGTTTTTGGGAAGCTTCAATGCAGCCATGTAACTTCCAAATGCATTGGAATCTGCATCAACCATAGTGAGCAACTTTTCAGCTGCATGATGAAATGGTGGAATCAATTCCCGCATCACCCCATCCNAAGACTCAAATTGACGTTTCCCATAGGTCATATGGCCCACCATGCAGCCCAGTGCTGCCCCCAATGCAGACACAGCTGCAGCAACAGAGCCACCACCAGGGGTAGCACTACGTGCACCCACACTTTGCACAAACCCCCGCAATGAATGGGTGAATATTGATGCCTCCGAAAGATCATCCCGGACAAGGTACTCCAATAATTCTTTGGTCGAGGAACAAAGGGGGGGCCAAAAATTCCAAACCAAAAAAGGGTAAAATTACCAATCCGGAATTTTGTGCTTCCCCCCCCCCAGGAACCAACCACCCTTCCCTCCTTTTTTGGAA
Full Trace Sequence: AGCAGACTATTGACCATTGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTCTTCCATCACACACTTGGAGCACAGACAGCGCACTTGTTTTTGCCTCATCCAACAGCCTGGAAACTTTCTCTTCAGTCTGACTTTTGAATTCAATATCCTTTATCTCCCGCAGATTGATTAGGACATTAAAGTAAGCCCCAAATACTCCAGTTTCTAATGCTTTGGCGGCTACCTGCAAATCAGATTTGCATGCAATGTTTCCATGTTTTGACATTTCCAGCAGAGGGTGCCACAAGGTATTGATGTGCTCTGCCAGAGTGAGTGGCACTTTAACAGCTTCCTTTAGGCCCTCCTGTAGGGCAGCAGAACGCTTCTCTTGCTCTTCAGCTGTGTTTTTGGGAAGCTTCAATGCAGCCATGTAACTTCCAAATGCATTGGAATCTGCATCAACCATAGTGAGCAACTTTTCAGCTGCATGATGAAATGGTGGAATCAATTCCCGCATCACCCCATCCNAAGACTCAAATTGACGTTTCCCATAGGTCATATGGCCCACCATGCAGCCCAGTGCTGCCCCCAATGCAGACACAGCTGCAGCAACAGAGCCACCACCAGGGGTAGCACTACGTGCACCCACACTTTGCACAAACCCCCGCAATGAATGGGTGAATATTGATGCCTCCGAAAGATCATCCCGGACAAGGTACTCCAATAATTCTTTGGTCGAGGAACAAAGGGGGGGCCAAAAATTCCAAACCAAAAAAGGGTAAAATTACCAATCCGGAATTTTGTGCTTCCCCCCCCCCAGGAACCAACCACCCTTCCCTCCTTTTTTGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTCTTCCATCACACACTTG