ORFeome > fus ORF1 – XORFeome v1.0

fus ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fus
Gene ID: 495123
Gene Page ID: 495118
ORF Xenbase ID: 17276403

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044319
Original XGC clone length: 1611

Human orthology & disease relationships

NCBI Entrez ID: 2521
Ensembl gene IDs: ENSG00000089280
Directly associated (OMIM) disease MIM numbers: 608030,614782
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,125853,148700,162210,164300,193520,214450,256710,300590,303600,602579,606003,607785,609065,609227

Library Location

Plate ID: GDExl11009
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ823630
dbEST ID: 79641332
Trimmed Sequence: ATGGCCACCAACGATTACTCCCAGCAAGCTAGCCAAGGGTATGGGGCATATCCCTCCCAGCCAAGCCAGGGTTATGGTCAGCAGCAGGGCAGCCAGACCTACGGCCAGCAAGGTTACAGTGGCTACAGCCAATCTGCAGGTGGCTCCTCGTATGGACAGAGTGGCTACAGCTCTGCGTATGGTCAAGATCAGAGCTCTGGGTATAGTTCTCAGTCAGCTCCACAACAAGGGTATGGATCTGGAAGTTATGGAAACTCCCAATCATCTCAGTCCTCTTATGGCAGCGGGCAGCCACAGCAGCCGTCCTCTTATTCTAGCTACTCGCAGCAGCCTCCAGCCAGTAGCAACACAGGAAGTTATGGTGGGAGCTCCCAGTCCCCTTCCTACCAGCAGCAACAAAGTGGTGGATATGGACAGCACGCAAGTGGGGGTTATGGAAGCCAGCAGAGCAGCTATGGAGGTCAACAACAATCCAGTTATGGGAGCCAGCACGGCCAGAGTAGCTACGGCAGTCAGCAGCAGCAGCCAAGCTCTTATGGACAGCAGCAATCAAGCTACAACCAGCCTCAGGGCTATAGCCAGCAGCAAACACAATATAGTGGCGGTGGAGCTGGTGGATATAATCATGACTCTCCTTCCATGGGCAGCGGAAGCTATGGTGGTGGATCTGATCACGGTGGCTATGGAGGGGCAGACAGCATAGGCGGACAGGGACGCGGAAGATTGGGTGGGCAAAGGAGGAGGCCGGCTTTTGACGTCC
Full Trace Sequence: GGGGACAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACCAACGATTACTCCCAGCAAGCTAGCCAAGGGTATGGGGCATATCCCTCCCAGCCAAGCCAGGGTTATGGTCAGCAGCAGGGCAGCCAGACCTACGGCCAGCAAGGTTACAGTGGCTACAGCCAATCTGCAGGTGGCTCCTCGTATGGACAGAGTGGCTACAGCTCTGCGTATGGTCAAGATCAGAGCTCTGGGTATAGTTCTCAGTCAGCTCCACAACAAGGGTATGGATCTGGAAGTTATGGAAACTCCCAATCATCTCAGTCCTCTTATGGCAGCGGGCAGCCACAGCAGCCGTCCTCTTATTCTAGCTACTCGCAGCAGCCTCCAGCCAGTAGCAACACAGGAAGTTATGGTGGGAGCTCCCAGTCCCCTTCCTACCAGCAGCAACAAAGTGGTGGATATGGACAGCACGCAAGTGGGGGTTATGGAAGCCAGCAGAGCAGCTATGGAGGTCAACAACAATCCAGTTATGGGAGCCAGCACGGCCAGAGTAGCTACGGCAGTCAGCAGCAGCAGCCAAGCTCTTATGGACAGCAGCAATCAAGCTACAACCAGCCTCAGGGCTATAGCCAGCAGCAAACACAATATAGTGGCGGTGGAGCTGGTGGATATAATCATGACTCTCCTTCCATGGGCAGCGGAAGCTATGGTGGTGGATCTGATCACGGTGGCTATGGAGGGGCAGACAGCATAGGCGGACAGGGACGCGGAAGATTGGGTGGGCAAAGGAGGAGGCCGGCTTTTGACGTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACCAACGATTACT

Sequences - 3ʹ (reverse) EST

Accession: JZ828931
dbEST ID: 79646633
Trimmed Sequence: ATAAAGCCTGTCCCTTCTGTCTTGCCTATCTCCCCTGGAATCCATTTTCCCTGGGCCACATCCTCCACCATCTCCACCTCGGCCGCCTCTAAACCCACCCCTGTCACCTCCCCTACCTCTGAAGCCCCCACGATCAAAGCCCCCACGGCCACCTCTTCTTTCGTCTCCAAAACCACCACCCATGCTGGAGCCGCCTGGACCACCAGGACCTTCAGGTTTAGGAGCCTTACACTGGTTACACTCATTTCTCCAAGACAAGTTCATGTTCTCACAGCCCGGGTTGGGGCATTTCCAGTCTCCCTCTCGTTGTTGGCCTCCTCCACCACTTGGGTATCCACCACTACCTCCCCGGCTGCTGCTTCCTCCAGGGGGCCCTCCAAATCCACCGCGTCCCATGGGTCCACCACGTCCTCTGCCTCTTCCATTGCCACCGCCTCAGCTATTGAAATCGGCTCGTCTTGTGGCACATGACACTTTAATCGGATTTCCTGAGAACTCTATGCCGTCCAACCAATCAATAGCGGCCTTGGCAGATGGAGGGTCATCAAAGGAAACTGTGGCTTCTCCTTTCAGTTTGCCAATTTCACGGTCTGTATATAGGTTGATCATTGACTGCCCAGACTTGCTGTTTATCTTGATGATTCCAATCTGTTTTAAAGTATTCCCGCAACTGAACTCAACTGTAAACATTCCTCTTCCCAGTCCCTTTCTCCCAAAA
Full Trace Sequence: AAGCTGCCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAAAGCCTGTCCCTTCTGTCTTGCCTATCTCCCCTGGAATCCATTTTCCCTGGGCCACATCCTCCACCATCTCCACCTCGGCCGCCTCTAAACCCACCCCTGTCACCTCCCCTACCTCTGAAGCCCCCACGATCAAAGCCCCCACGGCCACCTCTTCTTTCGTCTCCAAAACCACCACCCATGCTGGAGCCGCCTGGACCACCAGGACCTTCAGGTTTAGGAGCCTTACACTGGTTACACTCATTTCTCCAAGACAAGTTCATGTTCTCACAGCCCGGGTTGGGGCATTTCCAGTCTCCCTCTCGTTGTTGGCCTCCTCCACCACTTGGGTATCCACCACTACCTCCCCGGCTGCTGCTTCCTCCAGGGGGCCCTCCAAATCCACCGCGTCCCATGGGTCCACCACGTCCTCTGCCTCTTCCATTGCCACCGCCTCAGCTATTGAAATCGGCTCGTCTTGTGGCACATGACACTTTAATCGGATTTCCTGAGAACTCTATGCCGTCCAACCAATCAATAGCGGCCTTGGCAGATGGAGGGTCATCAAAGGAAACTGTGGCTTCTCCTTTCAGTTTGCCAATTTCACGGTCTGTATATAGGTTGATCATTGACTGCCCAGACTTGCTGTTTATCTTGATGATTCCAATCTGTTTTAAAGTATTCCCGCAACTGAACTCAACTGTAAACATTCCTCTTCCCAGTCCCTTTCTCCCAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAGGCCTGTCCCTTCTGT