ORFeome > fut8 ORF2 – XORFeome v1.0

fut8 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fut8
Gene ID: 954948
Gene Page ID: 954942
ORF Xenbase ID: 17276427

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125984
Original XGC clone length: 1737

Human orthology & disease relationships

NCBI Entrez ID: 2530
Ensembl gene IDs: ENSG00000033170
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 212066,230800,230900,607091

Library Location

Plate ID: GDExl11087
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGGCCATGGACGGGCTCCTGGCGTTGGATAATGCTTATCCTTTTCGCATGGGGGACCCTACTGTTTTACATTGGTGGGCACTTGGTGCGAGATAATGAAAACCCAGATCACTCCAGCAAAGAACTCTCCGAGATACTGGCAATACTTGAACGACTCACACACCATACTGAGGATGTTAGACAAATGGCTAAAAACCTTAATAACCTTGAGGGGCAAAACGCACAATGCGCTGTGGCAAGATAGACACAACTATTGCAAAATGCATAGTAAATCGCCCTTGAACCAGGACACATTTTCGTGCATGATCCCACCTCAGTTGAATCGCGACTCAAATAACATTACGCACATTTTATAACATACTTTTAATTAGCAACCGTTCACAGGCAGCGTGGCTCTTCAAACCCTTGAACCTCCAACTTACAAATAAACCCCCCTATTGCCAACATTCTTGAACCAACTTAGCACTATAATAAAACAATGCTTAACAATTTGTTAGCCCGAATAGGTCACTATCAATCAAAATTAAATCAATATCTGCCGTCCAACAAATAACAACTATAATGAGTCATATTACCTGGTCAAAGCTGTTTAAAGGAAAAACTTCCTCGAATAATAAAGCCCTGTAGTTACAAAAGCATAAAAATAGAAAAAAAGGAAAAGTTCCAATAAATCAAAAAACAAAAAAAATTAAAATTGCCCTTTCTCCCAAAAAGAAGAAAAAAAAAAAGAAAATACTTTTTTTTTGTTAAACGGACCGGTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGGCCATGGACGGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838089
dbEST ID: 79655791
Trimmed Sequence: TTTTGCGGCTTCTTGGTATGATGGATATTTGATTGTCTCTATTTTTTCCTTGACTTTGTACGATGGGTAAAGACCGGTCCTGCCTAACTTGCGGTTAATGCCCTTTGAGTAGCCGTCCCAGTGATTTCCGGCCACCCCAATAATGTCTCCAGGTTCCAAGGGGATTTCATCTGCATTCTGTGGCTGGTGGGGATATATTGCCACTTGGTTGTGAGCGTTCTGTCCGCCAAAGTAATAAATATCATCTAGGGAGTGGAAATAGGCTGACGCATCGGGGTGGAGTGTCTGCATGATTTCATATGCCACTCTGCACACCTGATTGGAGACAGTAGAGTCATCCCTATCTGCGTGCGACAGACTCTGCATGTAAAATATTACGCCCATACCTAGACTTAATCTATGAACTTTTATGAAAAACCACCTGCCCGTCAACATTCCCTTAATCGCCAGTAATTTGTGTACCCGAGTACACGTACTCTTCGGACTCTTGCTCCCGCCTATGATAAGGAAAGAAGCACGCTTATCAGTCAAAAAAGAAATAAGGACATCAAGGAAACAAGATTAATAAAAAATCTGTCGGTAGCGACTAGGAGGGAAGGGAAAGGAAAGGGGAGAAAGGGTGGTGTAAAAAATATAAACACGCAAAAATAAGAAGAAGCGAAAGAGGCGNGNAAAACGAAAAAGAAGAAGAAAAGGAGTAACAAAAAAAAACCATTGTGTGGGTCGGCGGGTCGGCGGCGGGGGGCGCGGGNGGAAAATGTATAGGAANGTAAAAAAAGNNGANN
Full Trace Sequence: GCGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTGCGGCTTCTTGGTATGATGGATATTTGATTGTCTCTATTTTTTCCTTGACTTTGTACGATGGGTAAAGACCGGTCCTGCCTAACTTGCGGTTAATGCCCTTTGAGTAGCCGTCCCAGTGATTTCCGGCCACCCCAATAATGTCTCCAGGTTCCAAGGGGATTTCATCTGCATTCTGTGGCTGGTGGGGATATATTGCCACTTGGTTGTGAGCGTTCTGTCCGCCAAAGTAATAAATATCATCTAGGGAGTGGAAATAGGCTGACGCATCGGGGTGGAGTGTCTGCATGATTTCATATGCCACTCTGCACACCTGATTGGAGACAGTAGAGTCATCCCTATCTGCGTGCGACAGACTCTGCATGTAAAATATTACGCCCATACCTAGACTTAATCTATGAACTTTTATGAAAAACCACCTGCCCGTCAACATTCCCTTAATCGCCAGTAATTTGTGTACCCGAGTACACGTACTCTTCGGACTCTTGCTCCCGCCTATGATAAGGAAAGAAGCACGCTTATCAGTCAAAAAAGAAATAAGGACATCAAGGAAACAAGATTAATAAAAAATCTGTCGGTAGCGACTAGGAGGGAAGGGAAAGGAAAGGGGAGAAAGGGTGGTGTAAAAAATATAAACACGCAAAAATAAGAAGAAGCGAAAGAGGCGNGNAAAACGAAAAAGAAGAAGAAAAGGAGTAACAAAAAAAAACCATTGTGTGGGTCGGCGGGTCGGCGGCGGGGGGCGCGGGNGGAAAATGTATAGGAANGTAAAAAAAGNNGANN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTGCGGCTTCTTGGTATG