ORFeome > fxr1 ORF1 – XORFeome v1.0

fxr1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fxr1
Gene ID: 1004715
Gene Page ID: 1004707
ORF Xenbase ID: 17276433

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043638
Original XGC clone length: 2028

Human orthology & disease relationships

NCBI Entrez ID: 8087
Ensembl gene IDs: ENSG00000114416
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 172700,233710,260540,600274,601104,607485

Library Location

Plate ID: GDExl11011
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ823885
dbEST ID: 79641587
Trimmed Sequence: ATGGAGGACCTGACGGTGGAAGTGCGCGGCTCTAACGGAGCTTTTTACAAGGGATTTATCAAGGATGTACATGAAGATTCCCTCACCGTTGTTTTTGAAAACAACTGGCAACCAGAGCGTCAGGTGCCTTTCAATGAGGTCCGGATGCCTCCTCTCCCTGATATTAAAAAGGAAATTACTGAAGGAGATGAGGTTGAGGTGTACTCCCGAGCTAATGACCAAGAACCTTGTGGATGGTGGTTGGCAAAAGTACGAATGATGAAAGGAGAGTTCTATGTTATTGAATATGCTGCTTGTGACGCTACCTACAATGAAATTGTAACATTTGAACGGCTGCGACCTGTAAACCAGAATAAAAGTGTAACAAAGAACTCTTTCTTCAAATGTACAGTAGATGTCCCTGAAGATTTAAGAGAATCGTGTTCTAATGAAAACGTGCATAAGGAATTCAAGAAAGCTGTAGGAGCCTGCCGAGTTTATTTTCATGCAGAAACTAATCAGCTAATAATACTGTCTGCAAGCGAATCAACTGTAAAGAGAGTAAACATATTGAGCGACATGCATTTGCGGAGTATCCGCACCAAACTGATGCTTATGTCAAGAAATGAAGAGGCCACAAAACATTTAGAATGTACAAAACAGCTTGCTTCAGCATTTCATGAAGAATTTGATGTTCGGNAAGATTTTAATGGGCTGGGGCATAGGACCCATGGAAAGTATATCCCACAAGCTANGAAAGGTTCCAGGTATACCTGGCTATTGAATTAAATGAAGAAATACGGCCGGTTCCAGTTTTTTGGGGAAAAGGGAAAAAACTGTTTAAAAAACAGGGGAGTACCGGGA
Full Trace Sequence: AATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGACCTGACGGTGGAAGTGCGCGGCTCTAACGGAGCTTTTTACAAGGGATTTATCAAGGATGTACATGAAGATTCCCTCACCGTTGTTTTTGAAAACAACTGGCAACCAGAGCGTCAGGTGCCTTTCAATGAGGTCCGGATGCCTCCTCTCCCTGATATTAAAAAGGAAATTACTGAAGGAGATGAGGTTGAGGTGTACTCCCGAGCTAATGACCAAGAACCTTGTGGATGGTGGTTGGCAAAAGTACGAATGATGAAAGGAGAGTTCTATGTTATTGAATATGCTGCTTGTGACGCTACCTACAATGAAATTGTAACATTTGAACGGCTGCGACCTGTAAACCAGAATAAAAGTGTAACAAAGAACTCTTTCTTCAAATGTACAGTAGATGTCCCTGAAGATTTAAGAGAATCGTGTTCTAATGAAAACGTGCATAAGGAATTCAAGAAAGCTGTAGGAGCCTGCCGAGTTTATTTTCATGCAGAAACTAATCAGCTAATAATACTGTCTGCAAGCGAATCAACTGTAAAGAGAGTAAACATATTGAGCGACATGCATTTGCGGAGTATCCGCACCAAACTGATGCTTATGTCAAGAAATGAAGAGGCCACAAAACATTTAGAATGTACAAAACAGCTTGCTTCAGCATTTCATGAAGAATTTGATGTTCGGNAAGATTTTAATGGGCTGGGGCATAGGACCCATGGAAAGTATATCCCACAAGCTANGAAAGGTTCCAGGTATACCTGGCTATTGAATTAAATGAAGAAATACGGCCGGTTCCAGTTTTTTGGGGAAAAGGGAAAAAACTGTTTAAAAAACAGGGGAGTACCGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACCTGACGGTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829194
dbEST ID: 79646896
Trimmed Sequence: AGACACCCCATTCAGTATGGCTTCTTGTTTACTTCCATCTTGACAGCTTGCATTGTTTCTTTCTGTGGGTGTGGTCTGTGGCTTTAAAGCCCTGTCAGCAGAAGTAGCTCTTGGGCCATTAATGACTTTTTCTGAAGGTCCGTGCTCTTCAATTACATCCTTCACCTTTTCCTTTTTGCCATTTTCCAAAGTTTCTTTAGGTAGATTTCGCTGTCGGCTTTGAGATTCTGCTCTAGAGATATAGTCAGCGACTGTAACTGGCTGTCTATCTTCTGCCTGACCCCTGAAGCGACGCCTGCGGCTACGATTGCGTCGCTGGGGTTTTTGCTCACTATCATCCAAGCCATTTTCATTAACTGATGCATTGTCAGACTCAGTCATTCCGTCCATTAAAGAGGAATCCTCATCAGTCCTCCTCCTCCGTGATCTCCTTCGACGGTTTGCGTTGTGGTGAGAGTCACTTGCATCTGTGTCAGCGGTCTGGTCAGATTCTGTGTTGTCAAGTAAGCTGTATGGGTTGCTGTCAGGATCCTTAAGCACAGAGCTGATAAAAGACTTTCCACCCCTTGATCCTCCCCGACCTCGAACAGCAGATCCACTACCCCCTCTACCCCCAGGGGCCCCTTCCGTTGTCACGCTTTTGGCGGCCCTTCACGTTTCGTCTTCACCAAC
Full Trace Sequence: GGCACGGAAGCAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACACCCCATTCAGTATGGCTTCTTGTTTACTTCCATCTTGACAGCTTGCATTGTTTCTTTCTGTGGGTGTGGTCTGTGGCTTTAAAGCCCTGTCAGCAGAAGTAGCTCTTGGGCCATTAATGACTTTTTCTGAAGGTCCGTGCTCTTCAATTACATCCTTCACCTTTTCCTTTTTGCCATTTTCCAAAGTTTCTTTAGGTAGATTTCGCTGTCGGCTTTGAGATTCTGCTCTAGAGATATAGTCAGCGACTGTAACTGGCTGTCTATCTTCTGCCTGACCCCTGAAGCGACGCCTGCGGCTACGATTGCGTCGCTGGGGTTTTTGCTCACTATCATCCAAGCCATTTTCATTAACTGATGCATTGTCAGACTCAGTCATTCCGTCCATTAAAGAGGAATCCTCATCAGTCCTCCTCCTCCGTGATCTCCTTCGACGGTTTGCGTTGTGGTGAGAGTCACTTGCATCTGTGTCAGCGGTCTGGTCAGATTCTGTGTTGTCAAGTAAGCTGTATGGGTTGCTGTCAGGATCCTTAAGCACAGAGCTGATAAAAGACTTTCCACCCCTTGATCCTCCCCGACCTCGAACAGCAGATCCACTACCCCCTCTACCCCCAGGGGCCCCTTCCGTTGTCACGCTTTTGGCGGCCCTTCACGTTTCGTCTTCACCAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACACCCCATTCAGTATGGCTT