ORFeome > fxr1 ORF3 – XORFeome v1.0

fxr1 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fxr1
Gene ID: 6252042
Gene Page ID: 1004707
ORF Xenbase ID: 17276445

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC131884
Original XGC clone length: 1950

Human orthology & disease relationships

NCBI Entrez ID: 8087
Ensembl gene IDs: ENSG00000114416
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 172700,233710,260540,600274,601104,607485

Library Location

Plate ID: GDExl11090
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ838537
dbEST ID: 79656239
Trimmed Sequence: ATGGAGGACATGACGGTGGAAAGTCTTCTATCAGTTCTGTGCTTAAGGATCCAGACAGCAACCCATACAGCTTACTTGACAACACAGAATCTGACCAGACCGCTGACACAGATGCAAGTGAGTCTCACCACAACACAAACCGTCGAAGGAGATCTCGGAGGAGGAGGACTGATGAGGATTCCTCACTAATGGACGGAATGACTGAGTCTGACAATGCATCTGTTAATGAAAATGGCTTGGTTACAGTTGCTGACTATATCTCTAGAGCAGAATCTCAAAGCCGGCAGCGAAATCTACCTAAAGAAACTTTGGCAAAAGGCAAAAAAGAAAAGGTGAAGGATGTAATTGAAGAGCACGGACCTTCGGAAAAAGTCATTAATGGCCCAAGAGCTTCTTCTGCCGACAAGGCTTCAAATCCACAGACCGCATCCACAGAAAGAAACCAAGCAAGCTGTCAAGATGGAAGTAAACAAGAAGCCATAATGAATGGGGTGTCTTT
Full Trace Sequence: TCGAGGCCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGACATGACGGTGGAAAGTCTTCTATCAGTTCTGTGCTTAAGGATCCAGACAGCAACCCATACAGCTTACTTGACAACACAGAATCTGACCAGACCGCTGACACAGATGCAAGTGAGTCTCACCACAACACAAACCGTCGAAGGAGATCTCGGAGGAGGAGGACTGATGAGGATTCCTCACTAATGGACGGAATGACTGAGTCTGACAATGCATCTGTTAATGAAAATGGCTTGGTTACAGTTGCTGACTATATCTCTAGAGCAGAATCTCAAAGCCGGCAGCGAAATCTACCTAAAGAAACTTTGGCAAAAGGCAAAAAAGAAAAGGTGAAGGATGTAATTGAAGAGCACGGACCTTCGGAAAAAGTCATTAATGGCCCAAGAGCTTCTTCTGCCGACAAGGCTTCAAATCCACAGACCGCATCCACAGAAAGAAACCAAGCAAGCTGTCAAGATGGAAGTAAACAAGAAGCCATAATGAATGGGGTGTCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCATCCAACTTATATCCCCTATAGTGAATCGTATTACTTAAAAAAAGATTAAAAAAAAAACACTTCTTGCCCGTGTCTCAAAAATCTCTGAATGTAACAAAAATTNTNTNGGGTGCTCGGGGCGAGGGGGGCCCCTCCGTCTTTATTTGTGTATTGTCGCATCAACGCACGATTATACGATTGTCGTTATTNNGCGGTTCTGAGAATACGCACGGGAGCAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACATGACGGTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838536
dbEST ID: 79656238
Trimmed Sequence: AGACACCCCATTCATTATGGCTTCTTGTTTACTTCCATCTTGACAGCTTGCTTGGTTTCTTTCTGTGGATGCGGTCTGTGGATTTGAAGCCTTGTCGGCAGAAGAAGCTCTTGGGCCATTAATGACTTTTTCCGAAGGTCCGTGCTCTTCAATTACATCCTTCACCTTTTCTTTTTTGCCTTTTGCCAAAGTTTCTTTAGGTAGATTTCGCTGCCGGCTTTGAGATTCTGCTCTAGAGATATAGTCAGCAACTGTAACCAAGCCATTTTCATTAACAGATGCATTGTCAGACTCAGTCATTCCGTCCATTAGTGAGGAATCCTCATCAGTCCTCCTCCTCCGAGATCTCCTTCGACGGTTTGTGTTGTGGTGAGACTCACTTGCATCTGTGTCAGCGGTCTGGTCAGATTCTGTGTTGTCAAGTAAGCTGTATGGGTTGCTGTCTGGATCCTTAAGCACAGAGCTGATAGAAGACTTTCCACCGTCATGTCCTCCATGG
Full Trace Sequence: GGGGAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACACCCCATTCATTATGGCTTCTTGTTTACTTCCATCTTGACAGCTTGCTTGGTTTCTTTCTGTGGATGCGGTCTGTGGATTTGAAGCCTTGTCGGCAGAAGAAGCTCTTGGGCCATTAATGACTTTTTCCGAAGGTCCGTGCTCTTCAATTACATCCTTCACCTTTTCTTTTTTGCCTTTTGCCAAAGTTTCTTTAGGTAGATTTCGCTGCCGGCTTTGAGATTCTGCTCTAGAGATATAGTCAGCAACTGTAACCAAGCCATTTTCATTAACAGATGCATTGTCAGACTCAGTCATTCCGTCCATTAGTGAGGAATCCTCATCAGTCCTCCTCCTCCGAGATCTCCTTCGACGGTTTGTGTTGTGGTGAGACTCACTTGCATCTGTGTCAGCGGTCTGGTCAGATTCTGTGTTGTCAAGTAAGCTGTATGGGTTGCTGTCTGGATCCTTAAGCACAGAGCTGATAGAAGACTTTCCACCGTCATGTCCTCCATGGTGGCCACTTTTTTGTACCAAGTTGCATTATAAAAAAGCTTGCTCATCAATTTGTTGCAACAAACAGGTGAGTATCAGTCAAATAGAAAAATTAATGGAAAACGCAACCTAAAAACTGAGCCGCATTTTTAAAGCGTCTGAACTGGGGGGGAGGGGCCGAGGGTGGGGAAGAANCCGTGGTTGAAGTTGATAAGGGGCAAAGCAGATGGGCTCTAGCTGTGGGTGCGGAGGGGGGGCTAGTGCGAGGNGGGGAGGGCGGAGGTAGGGTGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACACCCCATTCATTATGGCTT