ORFeome > fyttd1 ORF1 – XORFeome v1.0

fyttd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fyttd1
Gene ID: 1015374
Gene Page ID: 1015368
ORF Xenbase ID: 17276469

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097769
Original XGC clone length: 867

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ838433
dbEST ID: 79656135
Trimmed Sequence: ATGGCGCCGTTGAAAACCAGCGTTTCTGATACCATCGATAAAATAGATATGTCACTCGATGATATTATCAAATTAAACAAGCAAGAGCAGAACAGAAAGCAACTAAAAGGGAGATATAATGGCTCTTTCCGGCAGTTCAGGAACAGTTGGGGCAGGTGGGGAGCCCAGCACACTTCAGGTGCTGGAAACAATTTAAGGTCACAGGGGTTAAGGAAACGTCCATATGGTGTAAAAACAGGCCTGGCTATGCGCAAAATGGCATCATGGAAAGGCATAAGTCCTCTAAACCATCAACCTCTTGTGCGGAATTCCCCAGGCCAGCTTGTGTCATTTAGGAAGAGATTAAATCCTCAAAGGTCTCCAGACTCTGGGGTTAAAACCTCATCTTCATTGCAAAGATATTACTTGCGAAGCAGTAGCTATGCACCAACAAATACATTTAGAAGTGGATTCAGAATGGACCAACAGAGAGAAACCAGACAGGCAACATTCCTCTCCAGACGAGGCTTAGAGGTGCAGACACTGATGGACATGGATCAGCATTTAGATCTGCCAGAGCTTAGCAAGACACCTCCCTGGAGAACATCTGTAAGCAGCGGAGGGTCACTGACTGTTTCCATAGATAATCCATCTGCTGTAACATTAACCAGCTCTTTGGGTTCTAGGTTGCCTCGAGCTCCATTTCCATTCCTAACAAAAAAAGGAGGGGTCGG
Full Trace Sequence: GGCGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCCGTTGAAAACCAGCGTTTCTGATACCATCGATAAAATAGATATGTCACTCGATGATATTATCAAATTAAACAAGCAAGAGCAGAACAGAAAGCAACTAAAAGGGAGATATAATGGCTCTTTCCGGCAGTTCAGGAACAGTTGGGGCAGGTGGGGAGCCCAGCACACTTCAGGTGCTGGAAACAATTTAAGGTCACAGGGGTTAAGGAAACGTCCATATGGTGTAAAAACAGGCCTGGCTATGCGCAAAATGGCATCATGGAAAGGCATAAGTCCTCTAAACCATCAACCTCTTGTGCGGAATTCCCCAGGCCAGCTTGTGTCATTTAGGAAGAGATTAAATCCTCAAAGGTCTCCAGACTCTGGGGTTAAAACCTCATCTTCATTGCAAAGATATTACTTGCGAAGCAGTAGCTATGCACCAACAAATACATTTAGAAGTGGATTCAGAATGGACCAACAGAGAGAAACCAGACAGGCAACATTCCTCTCCAGACGAGGCTTAGAGGTGCAGACACTGATGGACATGGATCAGCATTTAGATCTGCCAGAGCTTAGCAAGACACCTCCCTGGAGAACATCTGTAAGCAGCGGAGGGTCACTGACTGTTTCCATAGATAATCCATCTGCTGTAACATTAACCAGCTCTTTGGGTTCTAGGTTGCCTCGAGCTCCATTTCCATTCCTAACAAAAAAAGGAGGGGTCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCCGTTGAAAACCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838432
dbEST ID: 79656134
Trimmed Sequence: TCCAACTGTCACAAATCTGCTCCCTTTAGTGAATGCCTGAGCAAGCCTTTGCTCTTTCAAAATCTTGAAGCGTTCATTTAGTGTGATTCCACTCTGTTTTGCCACACTGTTTATATCAAATTCTAGAGGGACTCCTTTAGGAACCTTTGTTTCTGAGCCTTCTTTCTTTGTTAGGAATGGAAATGGAGGTCGAGGCAACCTAGAACCCAAAGAGCTGGGTAATGTTACAGCAGATGGATTATCTATGGAAACAGTCAGTGACCCTCCGCTGCTTACAGATGTTCTCCAGGGAGGTGTCTTGCTAAGCTCTGGCAGATCTAAATGCTGATCCATGTCCATCAGTGTCTGCACCTTTAAGCCTCGTCTGGAGAGGAATGTTGCCTGTCTGGTTTCTCTCTGTTGGTCCATTCTGAATCCACTTCTAAATGTATTTGTTGGTGCGGAGCTACTGCTTCGCAGGTAATATCTTTGCAATGAGGATGAGGTTGTATCCCCACAATCTGGAGACGTTTGAAAATTAAATCTCTTCCGAAATGACACAAACAGGCCGGGGGGATTCGGCGGAAGAAGTTGAGGGATGGGAGGAGTTAGTGCTTTTCCTGATGGCTTTTGGGGGAGGGCGGAGCGGGGGGTCGTTCGGGGTCCACCGTTACTGTAACCCCACGGGAGGGGCAAGGGGGTGGGTCCACCTGGGACGGGGGGGGGG
Full Trace Sequence: GGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCAACTGTCACAAATCTGCTCCCTTTAGTGAATGCCTGAGCAAGCCTTTGCTCTTTCAAAATCTTGAAGCGTTCATTTAGTGTGATTCCACTCTGTTTTGCCACACTGTTTATATCAAATTCTAGAGGGACTCCTTTAGGAACCTTTGTTTCTGAGCCTTCTTTCTTTGTTAGGAATGGAAATGGAGGTCGAGGCAACCTAGAACCCAAAGAGCTGGGTAATGTTACAGCAGATGGATTATCTATGGAAACAGTCAGTGACCCTCCGCTGCTTACAGATGTTCTCCAGGGAGGTGTCTTGCTAAGCTCTGGCAGATCTAAATGCTGATCCATGTCCATCAGTGTCTGCACCTTTAAGCCTCGTCTGGAGAGGAATGTTGCCTGTCTGGTTTCTCTCTGTTGGTCCATTCTGAATCCACTTCTAAATGTATTTGTTGGTGCGGAGCTACTGCTTCGCAGGTAATATCTTTGCAATGAGGATGAGGTTGTATCCCCACAATCTGGAGACGTTTGAAAATTAAATCTCTTCCGAAATGACACAAACAGGCCGGGGGGATTCGGCGGAAGAAGTTGAGGGATGGGAGGAGTTAGTGCTTTTCCTGATGGCTTTTGGGGGAGGGCGGAGCGGGGGGTCGTTCGGGGTCCACCGTTACTGTAACCCCACGGGAGGGGCAAGGGGGTGGGTCCACCTGGGACGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCAACTGTCACAAATCTGCT