ORFeome > gabpa ORF1 – XORFeome v1.0

gabpa ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gabpa
Gene ID: 987254
Gene Page ID: 987249
ORF Xenbase ID: 17276553

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC077619
Original XGC clone length: 1359

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11054
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ832070
dbEST ID: 79649772
Trimmed Sequence: ATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATTGATGGCACAGAGAAGACCGAATGCACAGAAGAAGAAAGCATTATAGAACACACGTATAGCACAGCCGAGTTTGTCAGCCAGTCTATTGACATCAACGAGCCAATTGGAAATCTCAAGAAGTTGCTGGAGCCGAGACTTCAGTGTTCGCTAGATGCACATGAAATATGTTTGCAAGATATCCAGCTTGATCCTGATCGCAGTTTATTTGACCAAGGAGTAAAGACAGATGGATCAGTACAGCTCAGTGTTCAGGTGATCTCTCAGCAAGGGCTGGAGCCAAAACTAAACATCTTGGAAATTGTGAAGCCAGTGGAGACCGTTGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTAGAAGCTGAACTGGTTGAGGAAGCACAGGTGATCACTCTGGATGGGTCAAAACACATAACAACAATTTCTGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCATTGGAAGGCTACAGAAAGGAACAAGAACGCTTAGGCATTCCATATGATCCACTTCAATGGTCTGTTGATCAGGTTCTTCACTGGGTGCTCTGGGTAATGAAAGAATTCTGGTTGACTGAAATAAATGGTGACTCCCTCGGTATAACAGGAAGAGAACTCTTGCCACCTTAGCCCAGAAAAACTTTCTTCCAAAGAGTTCCCCAGAAGGAGAATTTTTGGGGGGATCCCTTTTGGGAACCTC
Full Trace Sequence: GGGGTCGTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATTGATGGCACAGAGAAGACCGAATGCACAGAAGAAGAAAGCATTATAGAACACACGTATAGCACAGCCGAGTTTGTCAGCCAGTCTATTGACATCAACGAGCCAATTGGAAATCTCAAGAAGTTGCTGGAGCCGAGACTTCAGTGTTCGCTAGATGCACATGAAATATGTTTGCAAGATATCCAGCTTGATCCTGATCGCAGTTTATTTGACCAAGGAGTAAAGACAGATGGATCAGTACAGCTCAGTGTTCAGGTGATCTCTCAGCAAGGGCTGGAGCCAAAACTAAACATCTTGGAAATTGTGAAGCCAGTGGAGACCGTTGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTAGAAGCTGAACTGGTTGAGGAAGCACAGGTGATCACTCTGGATGGGTCAAAACACATAACAACAATTTCTGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCATTGGAAGGCTACAGAAAGGAACAAGAACGCTTAGGCATTCCATATGATCCACTTCAATGGTCTGTTGATCAGGTTCTTCACTGGGTGCTCTGGGTAATGAAAGAATTCTGGTTGACTGAAATAAATGGTGACTCCCTCGGTATAACAGGAAGAGAACTCTTGCCACCTTAGCCCAGAAAAACTTTCTTCCAAAGAGTTCCCCAGAAGGAGAATTTTTGGGGGGATCCCTTTTGGGAACCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAAAAAGAGAGGCTGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ832071
dbEST ID: 79649773
Trimmed Sequence: TTTTTGAAGAGAAGCGGTAGCCAGTGTGACTGCTGTCATAGGCTGCCCAATGCTGTGTAATTGCATCTTCGCCATTTTCTTTTGTTCACATTCTGCCACCAACCGACTCAGTTCTGCTGCGCTGTAGCCAATTAGGGTCTTGAGATCACAAACAAACTTATAAACAAACCTCTTTCCTTGAACTTTACAGATCATGTCACCGTCATAGTAATACCGTAAAGCACGGCTAAGTTTTTCATAATTCATGGTGGGCTTGTTTTTTCGCTGTCCCCATTTTTGTGCTACCAATTCTGGCTGGTTTAATTTGAATTCTCCTTCATCACCAACCCATGAAATACAGTCTCTAGCGTCTTTGTCAGTGAGCAATTCTAGAAGAAACTGCCATAGCTGGATCTGCCCATTGTTCCCTGTTCTGTTTCCTGGTGAACTTCGGTCTTCCCCAGAAATGCGCGGCGTCCTTTGTATTTTTGCTACTTTGGTTTGACTATTTATTACTTTAATGGTTGTTTGTGCGGTTGGTTGGATTGATGCTGGTATAATGTGCACAGGCTGATCAATGGTAACTGTTGCAATTTCGCCTCCCTGTTCCTGGCTCGCCAAAACATATTTCCTAAGAAGCTCCNAATGACTCCACAAAATTCTCCTCTGGGGACTCCTTTGGAAGAGTCTTCTTGGCTAAAGGTTGCGAAGTCTCTTCCTGTTAATCCCGAAGGAATTCCAC
Full Trace Sequence: CGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTGAAGAGAAGCGGTAGCCAGTGTGACTGCTGTCATAGGCTGCCCAATGCTGTGTAATTGCATCTTCGCCATTTTCTTTTGTTCACATTCTGCCACCAACCGACTCAGTTCTGCTGCGCTGTAGCCAATTAGGGTCTTGAGATCACAAACAAACTTATAAACAAACCTCTTTCCTTGAACTTTACAGATCATGTCACCGTCATAGTAATACCGTAAAGCACGGCTAAGTTTTTCATAATTCATGGTGGGCTTGTTTTTTCGCTGTCCCCATTTTTGTGCTACCAATTCTGGCTGGTTTAATTTGAATTCTCCTTCATCACCAACCCATGAAATACAGTCTCTAGCGTCTTTGTCAGTGAGCAATTCTAGAAGAAACTGCCATAGCTGGATCTGCCCATTGTTCCCTGTTCTGTTTCCTGGTGAACTTCGGTCTTCCCCAGAAATGCGCGGCGTCCTTTGTATTTTTGCTACTTTGGTTTGACTATTTATTACTTTAATGGTTGTTTGTGCGGTTGGTTGGATTGATGCTGGTATAATGTGCACAGGCTGATCAATGGTAACTGTTGCAATTTCGCCTCCCTGTTCCTGGCTCGCCAAAACATATTTCCTAAGAAGCTCCNAATGACTCCACAAAATTCTCCTCTGGGGACTCCTTTGGAAGAGTCTTCTTGGCTAAAGGTTGCGAAGTCTCTTCCTGTTAATCCCGAAGGAATTCCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTGAAGAGAAGCGGTAGCCAG