ORFeome > gadd45g ORF1 – XORFeome v1.0

gadd45g ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gadd45g
Gene ID: 864811
Gene Page ID: 481954
ORF Xenbase ID: 17276583

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078567
Original XGC clone length: 480

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ839594
dbEST ID: 79657296
Trimmed Sequence: ATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAATGAGTCGTATTACATGGGTCATAAAAAAAAAAAGGCAGCACTGAGCCGTGTCTCGACTCCCTAAAAAGTAAAAGGNCNNTTGGCCCGCCTTGCCGCCCCCCGGGGGGGCGGGGGCTCTCCCTGGTGTTTCGGGTGGGGCCCCCCCGGTGGAAAATCCGTGGGGGAGAAATAAAAAAAAAAAAAAAAAAACCAAAAAAGAAGAAGGAGAAAAAAAAACACAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGGAAGAAGTTCACGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839593
dbEST ID: 79657295
Trimmed Sequence: CTCGGGCAGGGTGATAGTGGGAACCCAGTCATAGACTTTGCGGCTTTCCTCGCAGAATATAGCAAGTTTCTCCAGAGCTGGATCTTTCCATGCATCCTCATTTGGATTCGTAATAAGGATGCAGTGCAGGTCCTTGGGTTCTGCAGACTCATCAGTTAAGCCTAGTATTTGAGCGACTTTTTCTGTGTCGTTCAGCCTCACGATATCGATGTCATTTTCACAGCAGAAAGCTTGAATCAGAGTGAAGTGGATCTGAAGGGCTATATCACCTTCGTCGTATTCATCAGCAGCCAAAATGCAGAATGTAACACTGTCTGGATCTACATTCATGACTTTGGCAGACTCATAGACTCCAACGGTCAGACATTCCTGTCTCTGGGCAGAGACCAGTAGCTCATGCAGGGATTTGCCAGCACTTTGCATTCTGTCAGTGCTTTCAACAACGGTTTCTTGTCCGTGAACTTCTTCCAGAGTCATGG
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGGGCAGGGTGATAGTGGGAACCCAGTCATAGACTTTGCGGCTTTCCTCGCAGAATATAGCAAGTTTCTCCAGAGCTGGATCTTTCCATGCATCCTCATTTGGATTCGTAATAAGGATGCAGTGCAGGTCCTTGGGTTCTGCAGACTCATCAGTTAAGCCTAGTATTTGAGCGACTTTTTCTGTGTCGTTCAGCCTCACGATATCGATGTCATTTTCACAGCAGAAAGCTTGAATCAGAGTGAAGTGGATCTGAAGGGCTATATCACCTTCGTCGTATTCATCAGCAGCCAAAATGCAGAATGTAACACTGTCTGGATCTACATTCATGACTTTGGCAGACTCATAGACTCCAACGGTCAGACATTCCTGTCTCTGGGCAGAGACCAGTAGCTCATGCAGGGATTTGCCAGCACTTTGCATTCTGTCAGTGCTTTCAACAACGGTTTCTTGTCCGTGAACTTCTTCCAGAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATAAAAAAGAAAAACATAAGACAGGACCTACTTTACACAAACTGGAACGGGGAAAATCCCAAACTCTCCTCCAAAAGGGGCCGGTTACTTACCCGTTGTTAAGCGGAAGGCGCACCCGGGGAAGAAAACCTCTGGGGGGGAAAATTAAAGAAAAAAAAAAAAAACAACAAAGAGAGAAAAAAAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGGGCAGGGTGATAGT