ORFeome > gale ORF1 – XORFeome v1.0

gale ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gale
Gene ID: 965034
Gene Page ID: 965028
ORF Xenbase ID: 17276595

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC051601
Original XGC clone length: 1047

Human orthology & disease relationships

NCBI Entrez ID: 2582
Ensembl gene IDs: ENSG00000117308
Directly associated (OMIM) disease MIM numbers: 230350
Indirectly associated (Lage, et al.) disease MIM numbers: 230350,260920,600121,604232,607765

Library Location

Plate ID: GDExl11013
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ824117
dbEST ID: 79641819
Trimmed Sequence: ATGAACGGAAAGGTGCTTGTAACGGGAGGTGGTGGATATATTGGCAGTCACTGTGTGCTAGAATTGCTGGAGGCTGGATACAGTCCTGTAGTCATCGATAACTTCCACAATGCTATCCGGGGTGCCAACAATATACCAGAGAGTTTGCATCGAGTGCATGATATTGTTGGGAAGACAACTGAATTTGAGGAGGTGGATATTTTAGACCGTGCTGCTTTGGACAAATTATTTAGCAAGCACAAATTCTCAGCAGTCCTACATTTTGCTGGACTGAAGGCAGTTGGGGAGTCCGTACAGAAACCACTGCTGTATTATAAGGTGAACCTGACTGGCACCATCCAGCTACTAGAGGTAATGAATTCTCATGGGGTGAAGAATATAGTATTCAGCAGTTCTGCTACCGTATATGGTGATCCCAATTATTTACCTATAGATGAAAGCCATCCTGTTGGAGGGTGTACCAACCCTTATGGGAAAACCAAGTATTTTATTGAGGAGATGATCAAGGACCAGTGCAAAGCTGAGGAGGACTGGTGTGCCATTCTTCTGAGGTATTTTAACCCAATTGGAGCTCATGTTTCAGGAAGAATTGGAGAGGATCCCCAAGGAATACCAAACAACTTGATGCCATATGTTTCACAGGTGGCAGTGGGACGACGAGAATTCCTGAATGTATTTGGGGAATGATTACAACACACCAGAATGGACCTGGTGTCCGTGATTATATACACATTTGTAGATCTGGCTAAAGGGCACATTGCAACTCTTCAAAAAGTAAAAAACCTCCCCGGGGGCTGGTAAGGGATTCAAACCTGGGGAAC
Full Trace Sequence: AGTTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACGGAAAGGTGCTTGTAACGGGAGGTGGTGGATATATTGGCAGTCACTGTGTGCTAGAATTGCTGGAGGCTGGATACAGTCCTGTAGTCATCGATAACTTCCACAATGCTATCCGGGGTGCCAACAATATACCAGAGAGTTTGCATCGAGTGCATGATATTGTTGGGAAGACAACTGAATTTGAGGAGGTGGATATTTTAGACCGTGCTGCTTTGGACAAATTATTTAGCAAGCACAAATTCTCAGCAGTCCTACATTTTGCTGGACTGAAGGCAGTTGGGGAGTCCGTACAGAAACCACTGCTGTATTATAAGGTGAACCTGACTGGCACCATCCAGCTACTAGAGGTAATGAATTCTCATGGGGTGAAGAATATAGTATTCAGCAGTTCTGCTACCGTATATGGTGATCCCAATTATTTACCTATAGATGAAAGCCATCCTGTTGGAGGGTGTACCAACCCTTATGGGAAAACCAAGTATTTTATTGAGGAGATGATCAAGGACCAGTGCAAAGCTGAGGAGGACTGGTGTGCCATTCTTCTGAGGTATTTTAACCCAATTGGAGCTCATGTTTCAGGAAGAATTGGAGAGGATCCCCAAGGAATACCAAACAACTTGATGCCATATGTTTCACAGGTGGCAGTGGGACGACGAGAATTCCTGAATGTATTTGGGGAATGATTACAACACACCAGAATGGACCTGGTGTCCGTGATTATATACACATTTGTAGATCTGGCTAAAGGGCACATTGCAACTCTTCAAAAAGTAAAAAACCTCCCCGGGGGCTGGTAAGGGATTCAAACCTGGGGAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGGAAAGGTGCTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829425
dbEST ID: 79647127
Trimmed Sequence: GGATTCAGTGCTGAAACCTGTTGGATTTTGAGCCTGCCAGCGCCATAGATCTTCACACATCCTGTCTAGCCCATACTCTGCTTTCCAGCCTAGCTCTGCTTTGGCCAGTGCGGGATCTGCATAGCATGTAGCAATGTCACCTTCTCTCCTTGGGGCTATTTTATGTTGTATCTTCTTCCCAGAAGCCTTTTCCATTGCTTTCACCATCTCAAGAACAGAATAGCCTGTTCCAGTTCCCAGGTTGTATACCTTACAGCCACTGGAGGTCTCTAACTTTTTGAGAGCTGCAATGTGCCCTTTAGCCAGATCTACAATGTGTATATAATCACGGACACCAGTTCCATCTGGTGTGTTGTAATCATTCCCAAATACATTCAGGAATTCTCGTCGTCCCACTGCCACCTGTGAAACATATGGCATCAAGTTGTTTGGTATTCCTTGGGGATCCTCTCCAATTCTTCCTGAAACATGAGCTCCAATTGGGTTAAAATACCTCAGAAGAATGGCACACCAGTCCTCCTCAGCTTTGCACTGGTCCTTGATCATCTCCTCAATAAATACTTGGTTTTCCCATAAGGGTTGGTACACCCTCCAACGGGATGGCTTTCATCTATTAGGTAAATAATTGGGAATCACATATACGGTAGCAGAACTGGCTGAATACTATATTCTTCACCCCCTTGAGAATTTATTTACCTCTTATTAGCTGGGAAGGGTGCCAGGTCCAGGGTTCACCCTTTATAAAAAACACCCAGTGGGTTT
Full Trace Sequence: CCGGCAGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATTCAGTGCTGAAACCTGTTGGATTTTGAGCCTGCCAGCGCCATAGATCTTCACACATCCTGTCTAGCCCATACTCTGCTTTCCAGCCTAGCTCTGCTTTGGCCAGTGCGGGATCTGCATAGCATGTAGCAATGTCACCTTCTCTCCTTGGGGCTATTTTATGTTGTATCTTCTTCCCAGAAGCCTTTTCCATTGCTTTCACCATCTCAAGAACAGAATAGCCTGTTCCAGTTCCCAGGTTGTATACCTTACAGCCACTGGAGGTCTCTAACTTTTTGAGAGCTGCAATGTGCCCTTTAGCCAGATCTACAATGTGTATATAATCACGGACACCAGTTCCATCTGGTGTGTTGTAATCATTCCCAAATACATTCAGGAATTCTCGTCGTCCCACTGCCACCTGTGAAACATATGGCATCAAGTTGTTTGGTATTCCTTGGGGATCCTCTCCAATTCTTCCTGAAACATGAGCTCCAATTGGGTTAAAATACCTCAGAAGAATGGCACACCAGTCCTCCTCAGCTTTGCACTGGTCCTTGATCATCTCCTCAATAAATACTTGGTTTTCCCATAAGGGTTGGTACACCCTCCAACGGGATGGCTTTCATCTATTAGGTAAATAATTGGGAATCACATATACGGTAGCAGAACTGGCTGAATACTATATTCTTCACCCCCTTGAGAATTTATTTACCTCTTATTAGCTGGGAAGGGTGCCAGGTCCAGGGTTCACCCTTTATAAAAAACACCCAGTGGGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATTCAGTGCTGAAACCT