ORFeome > galm ORF1 – XORFeome v1.0

galm ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: galm
Gene ID: 1001029
Gene Page ID: 1001022
ORF Xenbase ID: 17276613

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129693
Original XGC clone length: 1029

Human orthology & disease relationships

NCBI Entrez ID: 130589
Ensembl gene IDs: ENSG00000143891
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 125851,175200,194200,223000,235700,600858,602485

Library Location

Plate ID: GDExl11090
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ838610
dbEST ID: 79656312
Trimmed Sequence: ATGACCTCTGTGACAAGGGATGTGTTTGGTCAATTGCTCGGAGGTGAAGGAACCGTGGAACGATTTTGCCTTCATTCTAAAGAAGTCAGAGCTGAGGTCATATCATTTGGCTGTATAATAACTCGTTTAGAAACCCAGGACAGGAATGGAACCTTTTCAGATCTAGTTCTTGGTTTTGATGTGATAGAAGGCTATACAAACAAACACCCTTATTTTGGAGCAGTTATTGGGCGGGTAGCAAACAGAATTGCCAATGGTAAATTCACTGTGAAAGGAAAGGATTATCGTTTGGCCATAAACAATGGACCGAACAGTATACACGGAGGCCTGAAAGGGTTTGACAAAGTGCTCTGGGCCCCTAAGATCATAGAAAATGGTGTCCAGTTCTTCTACAAAAGTGCAGACGGCGAGGAAGGGTACCCCGGCGAATTAAATGTGTGGGTGACATACACACTTATTGGCAGAACCTTGACTGTGAACTACAGAGCACAAAGTAATAACACTACACCTATAAATCTGACAAACCATTCCTACTTTAACTTGGCAGGAAAGGGCTCTAGTAATGTTTACGACCATGTGGTTTCCATTGATGCTTATCATTACCTGCCCGTTGATTACACCATGAAACCAACAGGGGAGGGTGGCGGCCGTTCCTGGGAACCTTGCTTTTAATTAAGGAAACCATTAAAACCTTGGCCGGCAGTTTGAGATCTTTTCCTTTAGATTGGCTTTTAAACACAATTTTTTGCCTTTGGGCAGTCCCGCGGA
Full Trace Sequence: CTCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCTCTGTGACAAGGGATGTGTTTGGTCAATTGCTCGGAGGTGAAGGAACCGTGGAACGATTTTGCCTTCATTCTAAAGAAGTCAGAGCTGAGGTCATATCATTTGGCTGTATAATAACTCGTTTAGAAACCCAGGACAGGAATGGAACCTTTTCAGATCTAGTTCTTGGTTTTGATGTGATAGAAGGCTATACAAACAAACACCCTTATTTTGGAGCAGTTATTGGGCGGGTAGCAAACAGAATTGCCAATGGTAAATTCACTGTGAAAGGAAAGGATTATCGTTTGGCCATAAACAATGGACCGAACAGTATACACGGAGGCCTGAAAGGGTTTGACAAAGTGCTCTGGGCCCCTAAGATCATAGAAAATGGTGTCCAGTTCTTCTACAAAAGTGCAGACGGCGAGGAAGGGTACCCCGGCGAATTAAATGTGTGGGTGACATACACACTTATTGGCAGAACCTTGACTGTGAACTACAGAGCACAAAGTAATAACACTACACCTATAAATCTGACAAACCATTCCTACTTTAACTTGGCAGGAAAGGGCTCTAGTAATGTTTACGACCATGTGGTTTCCATTGATGCTTATCATTACCTGCCCGTTGATTACACCATGAAACCAACAGGGGAGGGTGGCGGCCGTTCCTGGGAACCTTGCTTTTAATTAAGGAAACCATTAAAACCTTGGCCGGCAGTTTGAGATCTTTTCCTTTAGATTGGCTTTTAAACACAATTTTTTGCCTTTGGGCAGTCCCGCGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCTCTGTGACAAGGGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838609
dbEST ID: 79656311
Trimmed Sequence: AATAAGTGAAAACTCAAAACAGGTAGTGTGGTTGTATTCTTCTCCAGGATTTAGAAGAGAACTTGGAAAATGTGGCTTATTAACTGCATCAGGCCAGCCTTGTGTTTCCAAGCAAAATGCCGAATGTTTTGGGTACACTTTACCAGCCTTGCCCTTCAAAGATCCATCCAGGAAATTGGCAGTGTAGAACTGGACCCCAGGCTGAGTTGTGCTGACAGTTAGCACCCTGCCACTTAGCGGATGGCTGATCCTTGCGCATTGCTTCTGTTCCTGTGTGACGCCCAAGCAAAAATTGTGGTCAAAGCCATCTAAATGAAACGACTTTAAATGACTGCCAAGCTCTACTGGTTTCCTTAAATCAAAGCAAGTTCCCAGAACTGGCGCCACCTCCCCTGTTGGTATCATGGTGTCATCAACGGGCAGGTAATGATCAGCATCAATGGAAACCACATGGTCGTAAACATTACTAGAGCCCTGTCCTGCCAAGTTAAAGTAGGAATGGTTTGTCAGATTTATAGGTGTAGTGTTATTACTTTGTGCTCTGTATTTCACAGTCAAGGTTCTGCCAATAAGTGTGTATGTCACCCACACATTTAATTCGCCCGGGTACCCCTTCTCGCCGTCTGCACTTTTGTAAAAAACTGGAAACCATTTTCTATGAACTTAGGGGCCCCAAAGCAGCTTTGTCAAAACCTTTTCGGGCCTCCGTGTAAACCGGTTCGGGTCCCATTTTTTAGTGGCCGGAAAAAAAAAAACCCCTTTC
Full Trace Sequence: GGCAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATAAGTGAAAACTCAAAACAGGTAGTGTGGTTGTATTCTTCTCCAGGATTTAGAAGAGAACTTGGAAAATGTGGCTTATTAACTGCATCAGGCCAGCCTTGTGTTTCCAAGCAAAATGCCGAATGTTTTGGGTACACTTTACCAGCCTTGCCCTTCAAAGATCCATCCAGGAAATTGGCAGTGTAGAACTGGACCCCAGGCTGAGTTGTGCTGACAGTTAGCACCCTGCCACTTAGCGGATGGCTGATCCTTGCGCATTGCTTCTGTTCCTGTGTGACGCCCAAGCAAAAATTGTGGTCAAAGCCATCTAAATGAAACGACTTTAAATGACTGCCAAGCTCTACTGGTTTCCTTAAATCAAAGCAAGTTCCCAGAACTGGCGCCACCTCCCCTGTTGGTATCATGGTGTCATCAACGGGCAGGTAATGATCAGCATCAATGGAAACCACATGGTCGTAAACATTACTAGAGCCCTGTCCTGCCAAGTTAAAGTAGGAATGGTTTGTCAGATTTATAGGTGTAGTGTTATTACTTTGTGCTCTGTATTTCACAGTCAAGGTTCTGCCAATAAGTGTGTATGTCACCCACACATTTAATTCGCCCGGGTACCCCTTCTCGCCGTCTGCACTTTTGTAAAAAACTGGAAACCATTTTCTATGAACTTAGGGGCCCCAAAGCAGCTTTGTCAAAACCTTTTCGGGCCTCCGTGTAAACCGGTTCGGGTCCCATTTTTTAGTGGCCGGAAAAAAAAAAACCCCTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATAAGTGAAAACTCAAAACAGG