ORFeome > gap43 ORF1 – XORFeome v1.0

gap43 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gap43
Gene ID: 6255794
Gene Page ID: 5899284
ORF Xenbase ID: 17276673

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054277
Original XGC clone length: 405

Human orthology & disease relationships

NCBI Entrez ID: 2596
Ensembl gene IDs: ENSG00000172020
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 300577

Library Location

Plate ID: GDExl11002
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ839383
dbEST ID: 79657085
Trimmed Sequence: ATGCTGTGCTGTATGAGAAGAACAAAACAGGTGGAAAAGAATGAGGATGCTGAGCAAAAAATCGATAATGATGGTAACAAACCAGAGGACAAAGCTCACAAGGCCGCTACCAAAATCCAGGCCAGCTTCCGTGGACATATAATCAGGAAAAAAATGAAGGGAGACAAGAAAGACGACAGTAGCGAAGAGGCAGTAGAAAACCACAAAGGAGATGCAAAGGATGAGGCAGCTAAAACAGAGAATGAAACCCCCAAAACAGAGGAGCCCACTGCTGATGGTCCTTTAGAAGACAAGAAGGAGGCAATCAGCTCCCCGGCAGAAGACAAAAAAAACATCTTCAGAGAAGCCCCAGAACACCCCCTCAGAAGAGAAGCAAGCTGCAGCAGAGTCAGAGAGTACCACTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTGCTGTATGAGAAGAACAAAACAGGTGGAAAAGAATGAGGATGCTGAGCAAAAAATCGATAATGATGGTAACAAACCAGAGGACAAAGCTCACAAGGCCGCTACCAAAATCCAGGCCAGCTTCCGTGGACATATAATCAGGAAAAAAATGAAGGGAGACAAGAAAGACGACAGTAGCGAAGAGGCAGTAGAAAACCACAAAGGAGATGCAAAGGATGAGGCAGCTAAAACAGAGAATGAAACCCCCAAAACAGAGGAGCCCACTGCTGATGGTCCTTTAGAAGACAAGAAGGAGGCAATCAGCTCCCCGGCAGAAGACAAAAAAAACATCTTCAGAGAAGCCCCAGAACACCCCCTCAGAAGAGAAGCAAGCTGCAGCAGAGTCAGAGAGTACCACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGATCTGGCCCGTGTCTCAAACCCTTGAAGTTACACTCCCCGGGGGGGGGGGGTGGCGGGGTCCCCTCGCCCCCGGGGTGGAAAAAAAAAACGAAGAAAATAAAATACTGGGTCTGGTCCGGGAAACCAACCGGGGCGGACAAAAAACGTGCGGCAAGGACTTTTGGGGTTCACCACCCTGGGGGGGGAGGGGGGGAGAACGACAAGGGGGGGGGAAAGCCGCGGAAGGAGGGGGGTTATCTCGGTCCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTGCTGTATGAGAAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839382
dbEST ID: 79657084
Trimmed Sequence: GTGGTACTCTCTGACTCTGCTGCAGCTTGCTTCTCTTCTGAGGGGGTGTTCTGGGGCTTCTCTGAAGATGTTTTTTTTGTCTTCTGCCGGGGAGCTGATTGCCTCCTTCTTGTCTTCTAAAGGACCATCAGCAGTGGGCTCCTCTGTTTTGGGGGTTTCATTCTCTGTTTTAGCTGCCTCATCCTTTGCATCTCCTTTGTGGTTTTCTACTGCCTCTTCGCTACTGTCGTCTTTCTTGTCTCCCTTCATTTTTTTCCTGATTATATGTCCACGGAAGCTGGCCTGGATTTTGGTAGCGGCCTTGTGAGCTTTGTCCTCTGGTTTGTTACCATCATTATCGATTTTTTGCTCAGCATCCTCATTCTTTTCCACCTGTTTTGTTCTTCTCATACAGCACAGCATGATG
Full Trace Sequence: CGGGTAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGTACTCTCTGACTCTGCTGCAGCTTGCTTCTCTTCTGAGGGGGTGTTCTGGGGCTTCTCTGAAGATGTTTTTTTTGTCTTCTGCCGGGGAGCTGATTGCCTCCTTCTTGTCTTCTAAAGGACCATCAGCAGTGGGCTCCTCTGTTTTGGGGGTTTCATTCTCTGTTTTAGCTGCCTCATCCTTTGCATCTCCTTTGTGGTTTTCTACTGCCTCTTCGCTACTGTCGTCTTTCTTGTCTCCCTTCATTTTTTTCCTGATTATATGTCCACGGAAGCTGGCCTGGATTTTGGTAGCGGCCTTGTGAGCTTTGTCCTCTGGTTTGTTACCATCATTATCGATTTTTTGCTCAGCATCCTCATTCTTTTCCACCTGTTTTGTTCTTCTCATACAGCACAGCATGATGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAGTTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATAAAGGAACCGAAATAAAAAATGAAAGGCGTTTTACATCCCAATGGAGGGACGTGTCGGGTCTTATTTCTCCAAAAGGTTCTGGGGAGGAAACAGGATTGCAATTAAATAAGTTAAACCCGGGAGGCCTCCCCCGTTCGGGCCAACCCGGGGGGGGGGGTTTAGGGCGTCACCACAGGGCGCGACAAGGGGGCAAACACCCGGGGTGGGAGCGCGTGTGGTGTTTTTTTTTTTTTTAAAATTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGTACTCTCTGACTCT