ORFeome > gapdh ORF1 – XORFeome v1.0

gapdh ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gapdh
Gene ID: 865739
Gene Page ID: 487819
ORF Xenbase ID: 17276685

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043972
Original XGC clone length: 1002

Human orthology & disease relationships

NCBI Entrez ID: 2597
Ensembl gene IDs: ENSG00000111640
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,104300,124900,125370,125800,125851,137750,137760,140340,151623,161800,211980,223000,235700,266200,275355,301000,313400,313900,600652,602485,603278,603622,603813,604931,605249,606003,606657,608354,608355,608751,609065

Library Location

Plate ID: GDExl11016
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ824313
dbEST ID: 79642015
Trimmed Sequence: ATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAAACGAAAATAACGGGAATGGCTTTCCGTGTCCCCACCCCAATGGTGTCCGTCGTGGATCTGAACCTGCGCCTGCAGAGGCCGGGCAAGTACGATGACATCCAAGCCGGCACTTAAGACTGCATCAGAGGGGCCCAAATGAAGGGAATCCCGTGGGTACACACCAAAAAAC
Full Trace Sequence: AATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAAACGAAAATAACGGGAATGGCTTTCCGTGTCCCCACCCCAATGGTGTCCGTCGTGGATCTGAACCTGCGCCTGCAGAGGCCGGGCAAGTACGATGACATCCAAGCCGGCACTTAAGACTGCATCAGAGGGGCCCAAATGAAGGGAATCCCGTGGGTACACACCAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAAGGTTGGAATTAACGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829671
dbEST ID: 79647373
Trimmed Sequence: TTCCTTAGATGCCATGTGACACATAAGATCCACAACACGGTGGCTGTAGCCGCATTCATTATCATACCAGGAAACCAGTTTCACAAAGTTTTCATTCAGGGCAATTCCAGCATCAGCATCAAAGATGGAGGAGTGAGTGTCACCATTGAAGTCAGTGGAGACAACCTGGTCTTGTGTGTATCCCAGGATTCCCTTCATTGGGCCCTCTGATGCAGTCTTAATGGCGGCCTTGATGTCATCGTACTTGGCCGGCTTCTGCAGGCGGCAGGTCAGATCCACGACGGACACATTTGGGGTGGGGACACGGAAAGCCATTCCGGTTATTTTTCCGTTCAGCTCAGGGATAACTTTTCCGACAGCCTTTGCTGCACCAGTTGAGGCGGGAATAATGTTCTGACCTGCACCTCTGCCATCTCTCCACAGCTTCCCTGATGGGCCATCCACAGTCTTCTGGGTGGCAGTGAAAGCATGGACAGTTGTCATGAGTCCCTCAACAATGCCAAAGTTGTCGTTGATGACCTTTGCGAGAGGAGCCAGACAGTTTGTAGTGCAGGATGCATTGCTAACAACTTTAAGAGAGTTCTCATATTTCTCATGGTTCACGCCAACTACAAACATGGGGGCATNCTGCTGAGGGGGGCGGAGATAACGACACGGCTTGGCACCCTCCCTTCCAGTGCAGAGAGGGCTTTCCTCTGTTGGTTGTGAAGGACCTCCAGTTAGAATTCCAGCCACCATACCCCGGCCAACAAGCCATCTCCCCCACC
Full Trace Sequence: GACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCTTAGATGCCATGTGACACATAAGATCCACAACACGGTGGCTGTAGCCGCATTCATTATCATACCAGGAAACCAGTTTCACAAAGTTTTCATTCAGGGCAATTCCAGCATCAGCATCAAAGATGGAGGAGTGAGTGTCACCATTGAAGTCAGTGGAGACAACCTGGTCTTGTGTGTATCCCAGGATTCCCTTCATTGGGCCCTCTGATGCAGTCTTAATGGCGGCCTTGATGTCATCGTACTTGGCCGGCTTCTGCAGGCGGCAGGTCAGATCCACGACGGACACATTTGGGGTGGGGACACGGAAAGCCATTCCGGTTATTTTTCCGTTCAGCTCAGGGATAACTTTTCCGACAGCCTTTGCTGCACCAGTTGAGGCGGGAATAATGTTCTGACCTGCACCTCTGCCATCTCTCCACAGCTTCCCTGATGGGCCATCCACAGTCTTCTGGGTGGCAGTGAAAGCATGGACAGTTGTCATGAGTCCCTCAACAATGCCAAAGTTGTCGTTGATGACCTTTGCGAGAGGAGCCAGACAGTTTGTAGTGCAGGATGCATTGCTAACAACTTTAAGAGAGTTCTCATATTTCTCATGGTTCACGCCAACTACAAACATGGGGGCATNCTGCTGAGGGGGGCGGAGATAACGACACGGCTTGGCACCCTCCCTTCCAGTGCAGAGAGGGCTTTCCTCTGTTGGTTGTGAAGGACCTCCAGTTAGAATTCCAGCCACCATACCCCGGCCAACAAGCCATCTCCCCCACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTTAGATGCCATGTGAC