ORFeome > gas7 ORF1 – XORFeome v1.0

gas7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gas7
Gene ID: 1012677
Gene Page ID: 1012673
ORF Xenbase ID: 17276709

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127410
Original XGC clone length: 1425

Human orthology & disease relationships

NCBI Entrez ID: 8522
Ensembl gene IDs: ENSG00000007237
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,124900,132600,153640,153650,155100,155255,173900,259500,600652,603622,605249,609048,609322

Library Location

Plate ID: GDExl11087
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CGTGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGGAGCTCTGTGCAGAACTCTCTATGCATTTACTGGGGACCAGCACCAGCAGGGACTGAAGTTCGAGGCTGGGGAGGTGATTAAAGTCCTGCAGTTTTTAGACGGAGGCCGGTGGAAATGAAAATATTGCCGACTTTCATGTACGAACTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCGACGAACAGGTCAATATCCGTCGAAATAACATCATTATTTGTCCCCCAACGGAGATCCACCAACATGTCTCCTATTGGACGCCCGTATTAGTTCCCCGCCTTCTCTGGTGAGACGTCTTGAAAAACCGCCAAATTACATCAACCGTCAGCCTGAACAGCCCAATAGTCAAGAAGATGTCACTCCCTACAGTTAACGGTTTCCACTCATCCGGTCCCCCCGTCCATCAGCCCGAGTCAGGCAGCGTCCAAATACGCAAACCCATCAATGAGCACCACAATCCCGGATCCCCGTCCCTCACCAAAAATCAGAACAAGGAGACCACCATCACAATAAACTGTGTAACGTTCCCCCACCCAAACCCAATGCCCAAAACGCAGCCTTTTAAGCCTGGGGAGTGGAAATACTGTGACTATTTCTGGGCGGATAAAAAAAACGCACAAGGGAACAACACAGTTAACCGGGTTTGAGGAACTCCTTCAAAACCACTTAAGGGGCATATAATGGAGAAGGAAATGGGCCGAATTATTCCTAAAAAATTAAGGAATAAAAAAAAAAATTTGCAAAAAACCTGGCAAAACTCTCTCCAAAAGTTTTCCCCTGCCCTATTCCCGGAAGGAATGGAAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGGAGCTCTGTGCAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838094
dbEST ID: 79655796
Trimmed Sequence: TATCTCCATATCCACTGGCCTGATGTCTCCCGTCTTGTGCTCCTTCACCCACAGTTCTCTGTCTTTGCCCGGGTCCACTTTCTGGAGCACCTGATCCACTGGTTCTACCGTCCCTTGGTTGAACATGTCAGTTTCATGCCGTATCTGCGTGTACTGGCACAAGTGCTGACGGATCATCTCAACCCGTTCCACTTCCAGTCTCTCAAGCTCCACGGTCGTCGTGACCATCTCTTCAAACCACTTGGACTGACCTTGGTTGTACAGAACCCACAGCGCATCAAGACGTCTCCTGCTTGCGTTGACTTTCTCCGGGCCTTCTTAATGTCTTCTTCTGTCTTGTTGCTGAGTTTGATCTCCAGCTGCTGGGTCTTTACCTCAAGGTCTTTCTGCCTCTCGGCTAAGGCTTTCCGGGCCTTCTCCACTGCAGCATATCGACTAGCCAGCTGCTTGCGCAGGTCGGCGATGTGATGGTCAAACTTCTTCATGTCCTTCTTGAAATTCTCTCGAAAGTTAAGGAGAGGCTTCTCCACCTCACTCTGGTACTTAAAGGAAAACTTTAGGTGAACTTCTGCTTCATCTGCCAAACTTTTCTTCACTTGGTCCCAGGACTCCCCCCAGGGTTTCCTCCCTCCTAACTGGGCCAGGGAACTTTTGGAAAAACTTTGCCAGGGTTTTTTGCATATTCTTTCTTCAATCCCTTTTTCTTTTTCAGGTATAATTTCCGGCCATTTCCTTTCCGCCAATTTGTTTTTCCCCTTAAGACTTGCCTTTCCAAG
Full Trace Sequence: GGGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATCTCCATATCCACTGGCCTGATGTCTCCCGTCTTGTGCTCCTTCACCCACAGTTCTCTGTCTTTGCCCGGGTCCACTTTCTGGAGCACCTGATCCACTGGTTCTACCGTCCCTTGGTTGAACATGTCAGTTTCATGCCGTATCTGCGTGTACTGGCACAAGTGCTGACGGATCATCTCAACCCGTTCCACTTCCAGTCTCTCAAGCTCCACGGTCGTCGTGACCATCTCTTCAAACCACTTGGACTGACCTTGGTTGTACAGAACCCACAGCGCATCAAGACGTCTCCTGCTTGCGTTGACTTTCTCCGGGCCTTCTTAATGTCTTCTTCTGTCTTGTTGCTGAGTTTGATCTCCAGCTGCTGGGTCTTTACCTCAAGGTCTTTCTGCCTCTCGGCTAAGGCTTTCCGGGCCTTCTCCACTGCAGCATATCGACTAGCCAGCTGCTTGCGCAGGTCGGCGATGTGATGGTCAAACTTCTTCATGTCCTTCTTGAAATTCTCTCGAAAGTTAAGGAGAGGCTTCTCCACCTCACTCTGGTACTTAAAGGAAAACTTTAGGTGAACTTCTGCTTCATCTGCCAAACTTTTCTTCACTTGGTCCCAGGACTCCCCCCAGGGTTTCCTCCCTCCTAACTGGGCCAGGGAACTTTTGGAAAAACTTTGCCAGGGTTTTTTGCATATTCTTTCTTCAATCCCTTTTTCTTTTTCAGGTATAATTTCCGGCCATTTCCTTTCCGCCAATTTGTTTTTCCCCTTAAGACTTGCCTTTCCAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATCTCCATATCCACTGGCCT