ORFeome > gatad1 ORF1 – XORFeome v1.0

gatad1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gatad1
Gene ID: 6253912
Gene Page ID: 965953
ORF Xenbase ID: 17276757

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044066
Original XGC clone length: 738

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ823610
dbEST ID: 79641312
Trimmed Sequence: ATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAAC
Full Trace Sequence: GCCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGCTGGGACTAAAGCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828909
dbEST ID: 79646611
Trimmed Sequence: GTGGTTGGCCATCGTTTCCTTGATACTGATGGCTGGGGTGGGGCCAATGTGAGTCCAAATAAATCCCTTCTCAGGCCTGGTAGGAATGGTAGGGAAAGGGGAAGAGCGAGACTTGAAGTATTCAGAGGGAGCGTGGCACACAAATTCTAAGCACTCCATCTTCCTGGGGAGATCTTCATCTGGCCCTATAATGTATGTGGAGGGATCAAACCCGTCTTTTGGACTGGACAATGTAGGAATGAGCCAGGTGAGGGCGGCACTCTTCTCACAGTACTGATCCTGTATGAAACCTCTCACTTGGGCATAGTATGTTTTACCATCTTCCTCGTCCACAACAGAAACCACATCTCCAATCTGGTAGTAGAGGCCATTTTTCAGTTTGAATATGTGCCTCCTGCCCTTTCCTTTAGTAGAAACCTTCTTTTCAGCAGCCGGCGTAGCTTTGTACTTGGTGTTCCTGAGTCGAGCTGATCTGCGGTGGATTTCCTGCTTCGACTGTTTAGTGTTTCCACCATTACTCTGCTGGGAGGTGGAAGTACTTGCAAAGGTTGTGCCGGTATAAGAGCTGCTACCACTTGTGCTGCTGCTGCTGTTTGTAATTGTTGTTCCACCCGCAGCAGTGCCTGCTCTTGCCGCCTGCATTATAACACAGG
Full Trace Sequence: CCGCCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGTTGGCCATCGTTTCCTTGATACTGATGGCTGGGGTGGGGCCAATGTGAGTCCAAATAAATCCCTTCTCAGGCCTGGTAGGAATGGTAGGGAAAGGGGAAGAGCGAGACTTGAAGTATTCAGAGGGAGCGTGGCACACAAATTCTAAGCACTCCATCTTCCTGGGGAGATCTTCATCTGGCCCTATAATGTATGTGGAGGGATCAAACCCGTCTTTTGGACTGGACAATGTAGGAATGAGCCAGGTGAGGGCGGCACTCTTCTCACAGTACTGATCCTGTATGAAACCTCTCACTTGGGCATAGTATGTTTTACCATCTTCCTCGTCCACAACAGAAACCACATCTCCAATCTGGTAGTAGAGGCCATTTTTCAGTTTGAATATGTGCCTCCTGCCCTTTCCTTTAGTAGAAACCTTCTTTTCAGCAGCCGGCGTAGCTTTGTACTTGGTGTTCCTGAGTCGAGCTGATCTGCGGTGGATTTCCTGCTTCGACTGTTTAGTGTTTCCACCATTACTCTGCTGGGAGGTGGAAGTACTTGCAAAGGTTGTGCCGGTATAAGAGCTGCTACCACTTGTGCTGCTGCTGCTGTTTGTAATTGTTGTTCCACCCGCAGCAGTGCCTGCTCTTGCCGCCTGCATTATAACACAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGTTGGCCATCGTTTCCT