ORFeome > gdpgp1 ORF1 – XORFeome v1.0

gdpgp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gdpgp1
Gene ID: 5867405
Gene Page ID: 5867390
ORF Xenbase ID: 17276925

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153762
Original XGC clone length: 1200

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ839012
dbEST ID: 79656714
Trimmed Sequence: ATGGAGGAGGAGCATATAAATCAACGTCCCAGTGCTACTGTTGAAGAATATAGTTACTCTGAGGCAGATTTTGTGTTCTCAGGTTTATCATGGAAGGAAAGGCGTCAATATGCAGAAGACACAAGTTTCCTTTCACCTTTTGATAAAGCACTTCAAAGTAAATGGGAGCAGAAGATGAATGAGGGTTTATTTCGTTATCCCCTGAGAAACTTGCAGACTAAGATATTGCCAGGCTCTTTGAGCTATGTGGCCCAACTAAACATCCAGAGAAGTATAAACAGGAGAAAGCCAGAGGACATTTGGAGCATCCAACAGAAGTTTAACCCAAACCAATTTAATTATAATAAGATTAAACCTGAGGAAATTGTGTTTCAGATGATCAGGTCAGAAACTGAGCATTGTGTCGACTCAGACAAAGTACACGGCTCTTCAGTTAATGGTATGGGTACATCTGACTGTAAATCTGGATCCACTCACCAAAGATGTTGCATACTGGAATGCAAGGGGTGGTTGTACTTTAGTTGTAATCAATGTAAGCCCTCTTGAATTTGGCCATGTTTTATTTATGCCAGATCCTTCACTTTGCCTGCCGCACATTCTGACTGAGGATCTTATGTTGTTTGGCTTGGAATCTGTTCTTTTGAGTGCCATCCTGGGTTTAGAGTTGGGTTTAGTACCCTCGAAGGGTTTGCTTCTGTAAACCTCTACATCCTGCATGGGTTTTACTTGGACATTAACTTTTTCAAAAATCCTCCAACAACAAACCCCCGGTTTCCCGGAAGTGAAATTCCACTTTGAGCCCCGCGTTTTCCCTTC
Full Trace Sequence: GACCCCAAATAATAGATTTTATTTNTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGGAGCATATAAATCAACGTCCCAGTGCTACTGTTGAAGAATATAGTTACTCTGAGGCAGATTTTGTGTTCTCAGGTTTATCATGGAAGGAAAGGCGTCAATATGCAGAAGACACAAGTTTCCTTTCACCTTTTGATAAAGCACTTCAAAGTAAATGGGAGCAGAAGATGAATGAGGGTTTATTTCGTTATCCCCTGAGAAACTTGCAGACTAAGATATTGCCAGGCTCTTTGAGCTATGTGGCCCAACTAAACATCCAGAGAAGTATAAACAGGAGAAAGCCAGAGGACATTTGGAGCATCCAACAGAAGTTTAACCCAAACCAATTTAATTATAATAAGATTAAACCTGAGGAAATTGTGTTTCAGATGATCAGGTCAGAAACTGAGCATTGTGTCGACTCAGACAAAGTACACGGCTCTTCAGTTAATGGTATGGGTACATCTGACTGTAAATCTGGATCCACTCACCAAAGATGTTGCATACTGGAATGCAAGGGGTGGTTGTACTTTAGTTGTAATCAATGTAAGCCCTCTTGAATTTGGCCATGTTTTATTTATGCCAGATCCTTCACTTTGCCTGCCGCACATTCTGACTGAGGATCTTATGTTGTTTGGCTTGGAATCTGTTCTTTTGAGTGCCATCCTGGGTTTAGAGTTGGGTTTAGTACCCTCGAAGGGTTTGCTTCTGTAAACCTCTACATCCTGCATGGGTTTTACTTGGACATTAACTTTTTCAAAAATCCTCCAACAACAAACCCCCGGTTTCCCGGAAGTGAAATTCCACTTTGAGCCCCGCGTTTTCCCTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGGAGCATATAAATCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839011
dbEST ID: 79656713
Trimmed Sequence: TTTTCTTAAATACTCTACTAGATCTAAGGAAAGCTGTGTAAATTCATCATCAGCTAAGAGGCAATTATGAATAATGTCAATGACAGAATCTTCTGTAATGCTATTGAAATCCTCTTGATTTTTGACAGGCAGGTGGCCTGCTAGCTCACACAATGCCACATTGAAAGCAGATACCTCCTTGGCCCCAAAACTTGGCTTTCTTGCCCAGATATTAACTCGAATCCCATTTCTACCTTCAGAACCATTCCCTGTATCTGGATTACTGCCCCTTGTAATGAACAAATTATGGGCTATATTTTTAGCCACCAAAAAATCTGTAACCTTACATATGTTCTGGGCAGTAGATTTCAAGTTCCTCCCATCTGTGTAAAACAAAAAGCTCGGAGCAGGGAAATGGGTGATCAAGTGGAAGTTCATTTCAGGACACAGAGGCTTGCTGCTGGAGGACTCTATGAAAAGATCATGGTCAAGATAAAACCCATGCAGATGTAGATGGTTTACAGAAGCAAACCCTCCGAGGCTATTAAACCCAACTCTAAACCCAGGATGGGCACTCCAAAGAACAGAATCCAAGCCAAACAACATAAAATCCTCAGTCAAAATTTGCGGCAGGGGAAGGGAAGGAACTGGCATAAATAAAACATGGGCCAAATTCAAGAGGGCTTACATTTGATAACACCAAAAATAACAACAACCCTTGCCATTTCCCGTATGGCAACAACTTTTTTGGGAAGGGGAATCCGAAAATTTACAGTTTCCAAAAGT
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTCTTAAATACTCTACTAGATCTAAGGAAAGCTGTGTAAATTCATCATCAGCTAAGAGGCAATTATGAATAATGTCAATGACAGAATCTTCTGTAATGCTATTGAAATCCTCTTGATTTTTGACAGGCAGGTGGCCTGCTAGCTCACACAATGCCACATTGAAAGCAGATACCTCCTTGGCCCCAAAACTTGGCTTTCTTGCCCAGATATTAACTCGAATCCCATTTCTACCTTCAGAACCATTCCCTGTATCTGGATTACTGCCCCTTGTAATGAACAAATTATGGGCTATATTTTTAGCCACCAAAAAATCTGTAACCTTACATATGTTCTGGGCAGTAGATTTCAAGTTCCTCCCATCTGTGTAAAACAAAAAGCTCGGAGCAGGGAAATGGGTGATCAAGTGGAAGTTCATTTCAGGACACAGAGGCTTGCTGCTGGAGGACTCTATGAAAAGATCATGGTCAAGATAAAACCCATGCAGATGTAGATGGTTTACAGAAGCAAACCCTCCGAGGCTATTAAACCCAACTCTAAACCCAGGATGGGCACTCCAAAGAACAGAATCCAAGCCAAACAACATAAAATCCTCAGTCAAAATTTGCGGCAGGGGAAGGGAAGGAACTGGCATAAATAAAACATGGGCCAAATTCAAGAGGGCTTACATTTGATAACACCAAAAATAACAACAACCCTTGCCATTTCCCGTATGGCAACAACTTTTTTGGGAAGGGGAATCCGAAAATTTACAGTTTCCAAAAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTCTTAAATACTCTACTAGATC