ORFeome > gemin6 ORF1 – XORFeome v1.0

gemin6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gemin6
Gene ID: 951473
Gene Page ID: 951467
ORF Xenbase ID: 17276937

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108819
Original XGC clone length: 315

Human orthology & disease relationships

NCBI Entrez ID: 79833
Ensembl gene IDs: ENSG00000152147
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 253300,253400,253550,600334,603689,604145,608807,608808

Library Location

Plate ID: GDExl11085
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ837690
dbEST ID: 79655392
Trimmed Sequence: ATGACTCAATGGTCTAACAAAAGCCCACCGGAGTGGCAAGACTACATCAACAAAGAAGTAAAAGTCTCGGCTGATGAGAAGAAAGATTACCAGGGCTGGCTTGTAACAGTGGACCCAGTTTCTGCAAGTATTGTGCTGGCTAACTTCCAAGAAGAGCAGAAAACTTTAATTCGGGTGATCATGGGGCATGCGGTGCAAGAAGTACAAGTGGTGAACGAAGCAGATGAGGAGACCAAAGACAGACTTGCTCACCTCTTTACCCCCAGAGAAACGACAAGCTCCTACAGTAAAGAAGATTTGGAAAAAAGAAGCTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCAATGGTCTAACAAAAGCCCACCGGAGTGGCAAGACTACATCAACAAAGAAGTAAAAGTCTCGGCTGATGAGAAGAAAGATTACCAGGGCTGGCTTGTAACAGTGGACCCAGTTTCTGCAAGTATTGTGCTGGCTAACTTCCAAGAAGAGCAGAAAACTTTAATTCGGGTGATCATGGGGCATGCGGTGCAAGAAGTACAAGTGGTGAACGAAGCAGATGAGGAGACCAAAGACAGACTTGCTCACCTCTTTACCCCCAGAGAAACGACAAGCTCCTACAGTAAAGAAGATTTGGAAAAAAGAAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTAAAAAGAATCAAAAATCTCATTATTTTCACACACTAAGGCACGCGGGGCGAAAAGCAAAAAAATCGATCAACCAAAGGATGGGGGTTCGTTCCCCCTGTAGATGGTTGGGGGCGGCACCCCGGAGACTTAACCCCGCCGGGCAGGGGATTGGGGGGGGGAGAAACACGGGCCGGACGGGTGGGGCCGGAACATTACCGAAGGAAACGGGGGTCCGGGGGGGGGGGGGGATACTATGGGTTGTATAAATGTTTTTATTGCGN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCAATGGTCTAACAAAAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837689
dbEST ID: 79655391
Trimmed Sequence: GCTTCTTTTTTCCAAATCTTCTTTACTGTAGGAGCTTGTCGTTTCTCTGGGGGTAAAGAGGTGAGCAAGTCTGTCTTTGGTCTCCTCATCTGCTTCGTTCACCACTTGTACTTCTTGCACCGCATGCCCCATGATCACCCGAATTAAAGTTTTCTGCTCTTCTTGGAAGTTAGCCAGCACAATACTTGCAGAAACTGGGTCCACTGTTACAAGCCAGCCCTGGTAATCTTTCTTCTCATCAGCCGAGACTTTTACTTCTTTGTTGATGTAGTCTTGCCACTCCGGTGGGCTTTTGTTAAACCATTGAGTCATGG
Full Trace Sequence: GGGCAGGGAAAAGCCACTGAAGAAGGACAAACGAAGTCACTAAGACGGGGAAGAACAGCCAGGAGGGCAAAAAAGAGTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTCTTTTTTCCAAATCTTCTTTACTGTAGGAGCTTGTCGTTTCTCTGGGGGTAAAGAGGTGAGCAAGTCTGTCTTTGGTCTCCTCATCTGCTTCGTTCACCACTTGTACTTCTTGCACCGCATGCCCCATGATCACCCGAATTAAAGTTTTCTGCTCTTCTTGGAAGTTAGCCAGCACAATACTTGCAGAAACTGGGTCCACTGTTACAAGCCAGCCCTGGTAATCTTTCTTCTCATCAGCCGAGACTTTTACTTCTTTGTTGATGTAGTCTTGCCACTCCGGTGGGCTTTTGTTAAACCATTGAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTNGGGCCCGAGCTTAATAAAAAGAAAAGAATCAAAATATCATTACGCCGCACTAAGGAAACGCCGGGGAAAAAAGAAAAAAATAGCTCTTCCCAAGGCGGGGGGTGTGGGTAAGGGGGGATGGGGGGGGAGAGAAACCGGGGGGGAAAATCGGTGGGGGGGGGATTGGAATTGGAGGGCGGAGGGCGCGCAGACCCTGCCCAAAACATTGGAAAACGCCGCGGGGGGGGGGTTCAAGGGGGGTTAAAAGGTCTTGAGAAAAGGTTTTTTGGGGAAAAACAACCCCGGGGCGCGGAGAGGGAGGGGGTACCGCGGGGCGGGGTGGTGAAGGGAGAANGGGGGGGGGGGGGGGGGGGGGGAGGGAAGGGGGAGGGGGGAGGAGGTTAGGGGGGGGGGGGGNGCGCGGNGNCGGGAGAANGAAGGGGGGGGGGGGGAGGGGAGGGGGGGGGGGNGAGAGGGGNGGGGGGGGGGNNGGNNNNGGAGGAGGGGGGGGGGGGGNAGAGGGGGAGAGGGGANGGGAGGGGGGGGAGGGGAAAGAAAGAGAGGAGGAAGAGAGGAGGGNAGGAGGAGANGNGTGGGGGGAGAAGGGGGGAGGGGAGGAANNAGGAGNAAGGGGGGGGNAGNAGGCGGGGGGGAGAGGAGGAAGAGGGGGGAGGGGGGGGGNCGGAGGAAGGGGGGGAGGGGGGGGGAAGGAAGGGGGGGNCGGAGAGGGAGNAGGAGAGNGTTGGGGTATGAAACATAAGAAGGGGGGCGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTCTTTTTTCCAAATCTTCT