ORFeome > gemin8 ORF1 – XORFeome v1.0

gemin8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gemin8
Gene ID: 983957
Gene Page ID: 983950
ORF Xenbase ID: 17276943

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129664
Original XGC clone length: 699

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ837884
dbEST ID: 79655586
Trimmed Sequence: ATGGCAAGCATACCCCATCATGAAACTGAACCTTGGTACGCAGGGCGGGTTTATGCCAGGTACTGGAAGCATTACAGCCAGGCAATGTATTGGTTGTACAGACACAAAAGAGCATACAGTGTGGCTGTGGCATCTCTCTCCTATCCACCTTGGTATCCAGCTGTAAATTATCAGAACAGCAGAGGTTCTGATTGGGAAGGTGGTAAATTATCTCAGCCTGACACCTTCTCGAGGGAACACCGCCAGGTCATACATTCTCAAAGGGCACGTCCATGTTTAAAAGTATCAGAGTCCAAAGAAATTGAGTCTGAAATGGAGTGTGATAATGAAGTTCTATCTGATTCTGAGGAGGAAGGCATTGAATGTGACACCACCAACATGGAAATCACAGAGGAGTTACGAGAGTACTTTGCTGAGACAGAAAGGCACAGGGAGGAGTTGCGAAAGCAACAGCAGCTTGAGGCAGAAAATCATGAACAGTATATAGCAGCCGATCATGACCTGCACATAGCCACAAGAACATCAACCGAAGCACCCTCAGAAAGACCTGGGGAAAGGCGTAGAGCAGAAATGAAGAAATTGTATGGTGAAGATGCCCCAAAAATCCTAGGGATGGAGACCGCCATGCAGCTTAACTTTGACAGACACTGGTGATAAAAGCAACCAAAGTACTGGCCCCTCATCCCACTTAAATTTATTCCCAACTTTCTTGTACAAAGTTTGGCCTTTATTAGAAAACCATTTGGTTTTTTCATTTTTGTTTTCAACA
Full Trace Sequence: TCGAGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAAGCATACCCCATCATGAAACTGAACCTTGGTACGCAGGGCGGGTTTATGCCAGGTACTGGAAGCATTACAGCCAGGCAATGTATTGGTTGTACAGACACAAAAGAGCATACAGTGTGGCTGTGGCATCTCTCTCCTATCCACCTTGGTATCCAGCTGTAAATTATCAGAACAGCAGAGGTTCTGATTGGGAAGGTGGTAAATTATCTCAGCCTGACACCTTCTCGAGGGAACACCGCCAGGTCATACATTCTCAAAGGGCACGTCCATGTTTAAAAGTATCAGAGTCCAAAGAAATTGAGTCTGAAATGGAGTGTGATAATGAAGTTCTATCTGATTCTGAGGAGGAAGGCATTGAATGTGACACCACCAACATGGAAATCACAGAGGAGTTACGAGAGTACTTTGCTGAGACAGAAAGGCACAGGGAGGAGTTGCGAAAGCAACAGCAGCTTGAGGCAGAAAATCATGAACAGTATATAGCAGCCGATCATGACCTGCACATAGCCACAAGAACATCAACCGAAGCACCCTCAGAAAGACCTGGGGAAAGGCGTAGAGCAGAAATGAAGAAATTGTATGGTGAAGATGCCCCAAAAATCCTAGGGATGGAGACCGCCATGCAGCTTAACTTTGACAGACACTGGTGATAAAAGCAACCAAAGTACTGGCCCCTCATCCCACTTAAATTTATTCCCAACTTTCTTGTACAAAGTTTGGCCTTTATTAGAAAACCATTTGGTTTTTTCATTTTTGTTTTCAACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAAGCATACCCCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ837883
dbEST ID: 79655585
Trimmed Sequence: TAACTTCAGTGGGATGATGGGCCAGTACTTGGGTTGCTTTTTATCACAGTGTCTGTCAAAGTTAAGCTGCATGGCGGTCTCCATCCCTAGGATTTTTGGGGCATCTTCACCATACAATTTCTTCATTTCTGCTCTACGCCTTTCCCCAGGTCTTTCTGAGGGTGCTTCGGTTGATGTTCTTGTGGCTATGTGCAGGTCATGATCGGCTGCTATATACTGTTCATGATTTTCTGCCTCAAGCTGCTGTTGCTTTCGCAACTCCTCCCTGTGCCTTTCTGTCTCAGCAAAGTACTCTCGTAACTCCTCTGTGATTTCCATGTTGGTGGTGTCACATTCAATGCCTTCCTCCTCAGAATCAAATAGAACTTCATTATCACACTCCATTTCAGACTCAATTTCTTTGGACTCTGATACTTTTAAACATGGACGTGCCCTTTGAGAATGTATGACCTGGCGGTGTTCCCTCGAGAAGGTGTCGGGCTGAGATAATTTACCACCTTCCCAATCAGAACCTCTGCTGTTCTGATAATTTACAGCTGGATACCAAAGTGGATAGGAGAGAGATGCCACAGCCCCACTGTATGCTCTTTTGTGTCTGGACAACCAATACGGTTGCCTGGCTGTAATGCTTCCAGTACCTGCCAAAAACCCGCCCTGCGTACCGGAAGTTCAGTTCATGATTGAGTATACTTTGCATGGTGGCAACTTTTTTTGTCCAAGTGGCGATTATAAAAAAGCTTTCTCATCAATTTGTTCCACCGAGCAGGTCCGAGTCATTCAAAAAAAAAAAAGGAAAAAGGCCAGGACCTGAAAAATAGCAGTCNTTTATAAAGTCGTAAATTNGGNNNNGAGGGGGANNAGGAAAGGNGANGGGGGAGNAGAAGAAAGGGGAGGANGNANNGNNGGGGNAGGGAGGNGGNGAGAGGGGGGAGGGNGGGAGGNAAAGAGAGGGGAAANGGGAAAGGGAGAGAGGGGGAAAGGAGNGGGAGGGGGGNGGGGGGTAGGGGGGGGGGGANGGGTGNAGGGGAAAAGAAAGAAGAGAAAAAAAAAGAGAGAAAAAGGGAGAGAAGAAGAGAGGAAGGAAGAGAAAGAAGGAGAGGGGNGNNNNGGG
Full Trace Sequence: CGGCCGGGAATCAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAACTTCAGTGGGATGATGGGCCAGTACTTGGGTTGCTTTTTATCACAGTGTCTGTCAAAGTTAAGCTGCATGGCGGTCTCCATCCCTAGGATTTTTGGGGCATCTTCACCATACAATTTCTTCATTTCTGCTCTACGCCTTTCCCCAGGTCTTTCTGAGGGTGCTTCGGTTGATGTTCTTGTGGCTATGTGCAGGTCATGATCGGCTGCTATATACTGTTCATGATTTTCTGCCTCAAGCTGCTGTTGCTTTCGCAACTCCTCCCTGTGCCTTTCTGTCTCAGCAAAGTACTCTCGTAACTCCTCTGTGATTTCCATGTTGGTGGTGTCACATTCAATGCCTTCCTCCTCAGAATCAAATAGAACTTCATTATCACACTCCATTTCAGACTCAATTTCTTTGGACTCTGATACTTTTAAACATGGACGTGCCCTTTGAGAATGTATGACCTGGCGGTGTTCCCTCGAGAAGGTGTCGGGCTGAGATAATTTACCACCTTCCCAATCAGAACCTCTGCTGTTCTGATAATTTACAGCTGGATACCAAAGTGGATAGGAGAGAGATGCCACAGCCCCACTGTATGCTCTTTTGTGTCTGGACAACCAATACGGTTGCCTGGCTGTAATGCTTCCAGTACCTGCCAAAAACCCGCCCTGCGTACCGGAAGTTCAGTTCATGATTGAGTATACTTTGCATGGTGGCAACTTTTTTTGTCCAAGTGGCGATTATAAAAAAGCTTTCTCATCAATTTGTTCCACCGAGCAGGTCCGAGTCATTCAAAAAAAAAAAAGGAAAAAGGCCAGGACCTGAAAAATAGCAGTCNTTTATAAAGTCGTAAATTNGGNNNNGAGGGGGANNAGGAAAGGNGANGGGGGAGNAGAAGAAAGGGGAGGANGNANNGNNGGGGNAGGGAGGNGGNGAGAGGGGGGAGGGNGGGAGGNAAAGAGAGGGGAAANGGGAAAGGGAGAGAGGGGGAAAGGAGNGGGAGGGGGGNGGGGGGTAGGGGGGGGGGGANGGGTGNAGGGGAAAAGAAAGAAGAGAAAAAAAAAGAGAGAAAAAGGGAGAGAAGAAGAGAGGAAGGAAGAGAAAGAAGGAGAGGGGNGNNNNGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAACTTCAGTGGGATGATGG