ORFeome > gfpt2 ORF1 – XORFeome v1.0

gfpt2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gfpt2
Gene ID: 6256578
Gene Page ID: 942489
ORF Xenbase ID: 17276973

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043809
Original XGC clone length: 2046

Human orthology & disease relationships

NCBI Entrez ID: 9945
Ensembl gene IDs: ENSG00000131459
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 204000,268000,601777,602875,610015

Library Location

Plate ID: GDExl11013
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ824088
dbEST ID: 79641790
Trimmed Sequence: ATGTGCGGAATCTTTGCATACCTCAACTACCACGTGCCACGCACCAGGCGGGAGATCCTAGAAACACTCATCAAAGGCCTCCAGAGACTGGAATACAGAGGATACGACTCTGCAGGTGTGGGTATTGATGGTGGCAATGAAAAGAACTGGGAAAAGAACTCCAACCAAATCCAACTCATCAAGAAAAAGGGCAAAGTTAAGGCTTTGGATGAAGAAATAAACAAGCTTATAGACACGGACCTTGACATTGAATTTGAGATTCATTTGGGTATTGCACACACTCGGTGGGCCACACACGGAGAGCCAAGTCCCACAAACAGCCATCCACAGCGCTCTGACAAGAATAATGAGTTCATTGTAATTCACAATGGCATCATTACCAACTACAAAGACCTGAAGAAGTTTTTGGAGAGCAAAGGCTATGAATTTGAGTCTGAAACAGACACAGAAACCATTGCCAAGCTGGTGAAATACATGTATGACAACCGGGAATGTGATGAAATCAGCTTCACCACCCTGGTAGAGCGTGTAATACAGCAGCTGGAAGGGGCGTTTGCCCTTGTATTTAAAAGTGTTTATTTCCCAGGACAGGCTGTGGGGACCAGGAGGGGCAGCCCACTCTTGATGGGGGTACGAAGTGAACATAAGCTATCCACAGATCACATTCCCATCCTGTACCGTTCAGGTTTGGACAAGAAAGGGAGCTGCTCTTTGCCCAGGCTGGATAGCACCACCTGCCTGGTTTCCATTGAAGGAGAAAGCAAGGGGATTATATTTTCCCCTCAAAAGGCCACCGCAGTTTTTTGGGCCACCCCATACCGGGTTATTTTCCTGGGG
Full Trace Sequence: TAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGCGGAATCTTTGCATACCTCAACTACCACGTGCCACGCACCAGGCGGGAGATCCTAGAAACACTCATCAAAGGCCTCCAGAGACTGGAATACAGAGGATACGACTCTGCAGGTGTGGGTATTGATGGTGGCAATGAAAAGAACTGGGAAAAGAACTCCAACCAAATCCAACTCATCAAGAAAAAGGGCAAAGTTAAGGCTTTGGATGAAGAAATAAACAAGCTTATAGACACGGACCTTGACATTGAATTTGAGATTCATTTGGGTATTGCACACACTCGGTGGGCCACACACGGAGAGCCAAGTCCCACAAACAGCCATCCACAGCGCTCTGACAAGAATAATGAGTTCATTGTAATTCACAATGGCATCATTACCAACTACAAAGACCTGAAGAAGTTTTTGGAGAGCAAAGGCTATGAATTTGAGTCTGAAACAGACACAGAAACCATTGCCAAGCTGGTGAAATACATGTATGACAACCGGGAATGTGATGAAATCAGCTTCACCACCCTGGTAGAGCGTGTAATACAGCAGCTGGAAGGGGCGTTTGCCCTTGTATTTAAAAGTGTTTATTTCCCAGGACAGGCTGTGGGGACCAGGAGGGGCAGCCCACTCTTGATGGGGGTACGAAGTGAACATAAGCTATCCACAGATCACATTCCCATCCTGTACCGTTCAGGTTTGGACAAGAAAGGGAGCTGCTCTTTGCCCAGGCTGGATAGCACCACCTGCCTGGTTTCCATTGAAGGAGAAAGCAAGGGGATTATATTTTCCCCTCAAAAGGCCACCGCAGTTTTTTGGGCCACCCCATACCGGGTTATTTTCCTGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCGGAATCTTTGCATACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829396
dbEST ID: 79647098
Trimmed Sequence: CTCCACAGTCACGGACTTGGCCAAGTTCCTTGGACAATCCACATCGTAACCCCTCAGCACAGCGAGATGGAAAGCGAGGAGCTGCAGAGGAATTACGCTCAAGACCCCCTGCAGGCAGTCCACGGTGTGAGGGACCTTTATTGTTCGCTTGATGCTGTTAATGGTTTCTGTGTCCTCTTTATCACAAATGACAACTGGGCGGCCCTGACGAGCCACCACTTGTTGCAGGGCATTTTGGCACTTGGTGTAGGCATGATCCCTCATGATGATCATGATGACTGGCATAAGCTTGTCTACCAGGGCCAATGGGCCGTGCTTAAGCTCTCCTGCCAAGATCCCCTCTGAATGCATGTATGTGATTTCCTTAATTTTCAAAGCTCCTTCCATGCAGGTTGAGTAGTGATATCCACGGCCCATAATAAGGACCGATTTCTGCTGGTACAATTCTGATGCCAGCTTCTGAATCTCATCATCCAGGCTAAGCACTTCTTTAATGTTGTCTGGTAAGATTTGCAGGGCGTTCATGATCTGCTTACGTCGCTCCTGTATGGATATCCGATCATCACACATCATCAGGGCAAACATTATGAGGGATACAAACTGGCTAATATAGGGCTTTGTACTGGCCACACCAATTTCAGGGCCCACGTTGAATTGTACCCCCACATCCGGTCTCTCTGGAAAATGAACTGGCCCAGGGGGTTTGGTTACCCCCAACAGGCCGGGCACACCCTTCTTTTTTTACAAAAACGGGAAAGGGCAAAGCA
Full Trace Sequence: GGGCAGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCACAGTCACGGACTTGGCCAAGTTCCTTGGACAATCCACATCGTAACCCCTCAGCACAGCGAGATGGAAAGCGAGGAGCTGCAGAGGAATTACGCTCAAGACCCCCTGCAGGCAGTCCACGGTGTGAGGGACCTTTATTGTTCGCTTGATGCTGTTAATGGTTTCTGTGTCCTCTTTATCACAAATGACAACTGGGCGGCCCTGACGAGCCACCACTTGTTGCAGGGCATTTTGGCACTTGGTGTAGGCATGATCCCTCATGATGATCATGATGACTGGCATAAGCTTGTCTACCAGGGCCAATGGGCCGTGCTTAAGCTCTCCTGCCAAGATCCCCTCTGAATGCATGTATGTGATTTCCTTAATTTTCAAAGCTCCTTCCATGCAGGTTGAGTAGTGATATCCACGGCCCATAATAAGGACCGATTTCTGCTGGTACAATTCTGATGCCAGCTTCTGAATCTCATCATCCAGGCTAAGCACTTCTTTAATGTTGTCTGGTAAGATTTGCAGGGCGTTCATGATCTGCTTACGTCGCTCCTGTATGGATATCCGATCATCACACATCATCAGGGCAAACATTATGAGGGATACAAACTGGCTAATATAGGGCTTTGTACTGGCCACACCAATTTCAGGGCCCACGTTGAATTGTACCCCCACATCCGGTCTCTCTGGAAAATGAACTGGCCCAGGGGGTTTGGTTACCCCCAACAGGCCGGGCACACCCTTCTTTTTTTACAAAAACGGGAAAGGGCAAAGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCACAGTCACGGACTT