ORFeome > ggact ORF1 – XORFeome v1.0

ggact ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ggact
Gene ID: 961430
Gene Page ID: 961427
ORF Xenbase ID: 17276985

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078529
Original XGC clone length: 417

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ839908
dbEST ID: 79657610
Trimmed Sequence: ATGACATGCTACAAACACGGAAAAGCAGTTTTTAAAGGAATGGGCAAAGCAGTAGAGAAATATCCACTGGTGATTGCGGAGGAGGCCAACATCCCATTCTTACTGAACATTCCAGGAACAGGGAGACGTATTATAGGAGAGATCTACTCTGTCGATGAGCAGCTGCTGCACTTCCTCGATGACTTTGAAGGCTGCCCAAACTGGTACCAACGGACTCCTCAGGAGATTGAAATATTGGAGTGGGAAGGTACAGACGATTCCCCGGATGAGAGACCCGCTGCTAACAGCATCATCACCTGCTTCGTCTACAGCACAACCTGCTACCAGCCAGAGTGGCTTCAGTTGCCCTATCATAAATGCTACGATGCCTTTGGGAACCATGGTCTACGTTATATCAGGCACCGGGATATAATCTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACATGCTACAAACACGGAAAAGCAGTTTTTAAAGGAATGGGCAAAGCAGTAGAGAAATATCCACTGGTGATTGCGGAGGAGGCCAACATCCCATTCTTACTGAACATTCCAGGAACAGGGAGACGTATTATAGGAGAGATCTACTCTGTCGATGAGCAGCTGCTGCACTTCCTCGATGACTTTGAAGGCTGCCCAAACTGGTACCAACGGACTCCTCAGGAGATTGAAATATTGGAGTGGGAAGGTACAGACGATTCCCCGGATGAGAGACCCGCTGCTAACAGCATCATCACCTGCTTCGTCTACAGCACAACCTGCTACCAGCCAGAGTGGCTTCAGTTGCCCTATCATAAATGCTACGATGCCTTTGGGAACCATGGTCTACGTTATATCAGGCACCGGGATATAATCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCTCTATAGTGAGTCCTATTACATGGTCATAGCTGTTTCCTGAAAAAAAAAACCCAAAATCCAAAATCTAAAAAAGTAAAAAATGGGAAGAATAAAAAAAAAAAAAAATAATCCCCCACCAAGAGGCGCTGGGGTTTCTAAAAAAAAAAAAATAAAAAAAATCAACCATAGAAAAAACCCCCCCCTCGCTTAAACACATAAAGAAAAAAAAACACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCAGATGTGGTGGGCGAGAACCCGCCCGCCCCCCATTATTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACATGCTACAAACACGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839907
dbEST ID: 79657609
Trimmed Sequence: GATTATATCCCGGTGCCTGATATAACGTAGACCATGGTTCCCAAAGGCATCGTAGCATTTATGATAGGGCAACTGAAGCCACTCTGGCTGGTAGCAGGTTGTGCTGTAGACGAAGCAGGTGATGATGCTGTTAGCAGCGGGTCTCTCATCCGGGGAATCGTCTGTACCTTCCCACTCCAATATTTCAATCTCCTGAGGAGTCCGTTGGTACCAGTTTGGGCAGCCTTCAAAGTCATCGAGGAAGTGCAGCAGCTGCTCATCGACAGAGTAGATCTCTCCTATAATACGTCTCCCTGTTCCTGGAATGTTCAGTAAGAATGGGATGTTGGCCTCCTCCGCAATCACCAGTGGATATTTCTCTACTGTTTTGCCCATTCCTTTAAAAACTGCTTTTCCGTGTTTGTAGCATGTCATGG
Full Trace Sequence: GAAACTGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTATATCCCGGTGCCTGATATAACGTAGACCATGGTTCCCAAAGGCATCGTAGCATTTATGATAGGGCAACTGAAGCCACTCTGGCTGGTAGCAGGTTGTGCTGTAGACGAAGCAGGTGATGATGCTGTTAGCAGCGGGTCTCTCATCCGGGGAATCGTCTGTACCTTCCCACTCCAATATTTCAATCTCCTGAGGAGTCCGTTGGTACCAGTTTGGGCAGCCTTCAAAGTCATCGAGGAAGTGCAGCAGCTGCTCATCGACAGAGTAGATCTCTCCTATAATACGTCTCCCTGTTCCTGGAATGTTCAGTAAGAATGGGATGTTGGCCTCCTCCGCAATCACCAGTGGATATTTCTCTACTGTTTTGCCCATTCCTTTAAAAACTGCTTTTCCGTGTTTGTAGCATGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCAAAAATAAAAACTGGACATCGTTTATACGCTTTGGAACGGGGGTGGTTCATAACCCCCAAGCCCCTGCTACAAAGGTGCGGGTGCCCATTTGTTAATAAAAAAAAACCACCAAAGGACAAAAACCGGGGGGGGAGGATGGGTGGAAAGAACGCGGGCGCAGGAGCGGACAAAACTTTTNGGCACCGGGGGGGAGGCGCCCGCGGGTGTTTTTTTGTTTTGGTGTGTTGTGTGTGGGGACG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTATATCCCGGTGCCT