ORFeome > ghitm ORF1 – XORFeome v1.0

ghitm ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ghitm
Gene ID: 6254941
Gene Page ID: 971738
ORF Xenbase ID: 17277033

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041226
Original XGC clone length: 1044

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ823632
dbEST ID: 79641334
Trimmed Sequence: ATGTTTGCAGCAAGGTTAGCCTGTATGCGGAGCCTGCCTGTGTTGGCCTTCCGCCCAGCAATAACTCACGGCTCTCCATTCCTGAGAAATTCTGCACTGAAAACAAACCAATGTATTTTGCAGCCTAACCAGGGTTATGCATCAAAAACCAGGTTTGGGTTGCGCCGTGTTAAGTCTGCCCGTGAACAAATCAAAGAGGCTGCATTTGAACCATCAATGGATACAGCTGCTCGATTTGACACAACCGGCAGGCTCATAGTCGCAGGAGGTGCTGTGGTTGGCCTTGGTGCTCTTTGTTATTATGGACTGGGAATGTCCAATGAAATTGGTGCCATAGATAAGGCTGTTATTTGGCCTCAGTATGTGAAAGAGAGAATTCGATCTACCTACATGTATTTTGCTGGCAGTATTGGCCTCACAGCCCTCTCTGCTGTGGCGGTTAGTAGGTCACCTGCTCTTATGAGCTTGATGATGAGAGGCTCCTGGCTGGCAATTGGTGCAACTTTTGCTGCAATGATTGGAGCTGGGATGTTGGTTCGTTCTATATCCTATGATCAAAGCCCGGGAGCTAAACATCTTGCATGGATGTTGCATGCAGGAGTGATGGGGGCAGTGGTTGCTCCATTGACTTTGCTTGGTGGCCCTCTGCTGATTAGAGCTGCTTGGTACACAGCTGGAATTGTTGGAGGTCTTTCCACTGTGGCTATGTGTGCACCAAGTGAGAAGTTCTAAATATGGGAGGGCCTCTTGGTGTTGGTCTGGGACTTGTCCCTTGCTCCCTCCATAGGGAGTGCGTTTTCTTCCTCCCAACTTCTGGCTTTTTGGC
Full Trace Sequence: AGTTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTGCAGCAAGGTTAGCCTGTATGCGGAGCCTGCCTGTGTTGGCCTTCCGCCCAGCAATAACTCACGGCTCTCCATTCCTGAGAAATTCTGCACTGAAAACAAACCAATGTATTTTGCAGCCTAACCAGGGTTATGCATCAAAAACCAGGTTTGGGTTGCGCCGTGTTAAGTCTGCCCGTGAACAAATCAAAGAGGCTGCATTTGAACCATCAATGGATACAGCTGCTCGATTTGACACAACCGGCAGGCTCATAGTCGCAGGAGGTGCTGTGGTTGGCCTTGGTGCTCTTTGTTATTATGGACTGGGAATGTCCAATGAAATTGGTGCCATAGATAAGGCTGTTATTTGGCCTCAGTATGTGAAAGAGAGAATTCGATCTACCTACATGTATTTTGCTGGCAGTATTGGCCTCACAGCCCTCTCTGCTGTGGCGGTTAGTAGGTCACCTGCTCTTATGAGCTTGATGATGAGAGGCTCCTGGCTGGCAATTGGTGCAACTTTTGCTGCAATGATTGGAGCTGGGATGTTGGTTCGTTCTATATCCTATGATCAAAGCCCGGGAGCTAAACATCTTGCATGGATGTTGCATGCAGGAGTGATGGGGGCAGTGGTTGCTCCATTGACTTTGCTTGGTGGCCCTCTGCTGATTAGAGCTGCTTGGTACACAGCTGGAATTGTTGGAGGTCTTTCCACTGTGGCTATGTGTGCACCAAGTGAGAAGTTCTAAATATGGGAGGGCCTCTTGGTGTTGGTCTGGGACTTGTCCCTTGCTCCCTCCATAGGGAGTGCGTTTTCTTCCTCCCAACTTCTGGCTTTTTGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTGCAGCAAGGTTAGCCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ828937
dbEST ID: 79646639
Trimmed Sequence: TTTTCGTCTGTTTCCACCTCCAGCCAGCATCATTGCTACACGTATAAAGATATTTAGTGTGTCAGTGTAAATTCCCAAGCACGAATTTATGGGGTCAAATTTTGCTACACCATACATTGGAGTGGTCTCAGCTCGTTTGATGACTTTCTGGGTATCATATAGAAGAAACATGCCAAAAAGTACTAAGCCCCCATAAATGGCAATGGAGTAAAGGCCAGCGCCAAAAGCAGAAGTTGGAGGAAGAAACGCACTCCCTATGGAGGAAGCAAGGACAAGTCCCAGACCAACACCAAGAGGCCCTCCCATATTTAGAAACTTCTCACTTGGTGCACACATAGCCACAGTGGAAAGACCTCCAACAATTCCAGCTGTGTACCAAGCAGCTCTAATCAGCAGAGGGCCACCAAGCAAAGTCAATGGAGCAACCACTGCCCCCATCACTCCTGCATGCAACATCCATGCAAGATGTTTAGCTCCCGGGCTTTGATCATAGGATATAGAACGAACCAACATCCCAGCTCCAATCATTGCAGCAAAAGTTGCACCAATTGCCAGCCAGGAGCCTCTCATCATCAAGCTCATAAGAGCAGGTGACCTACTAACCGCCACAGCAGAGAGGGCTGTGAGGCCAATACTGCCAGCAAAATACATGTAGGTAGATCGAATTCTCTCTTTCACATACTGAGGGCCAAATACAAGCCTTAATCTATTGGAACCATTTTCAATTGGAACATTTCCCCAATCCCATAAAAAAACAAAAAA
Full Trace Sequence: CCGAGTACCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTCGTCTGTTTCCACCTCCAGCCAGCATCATTGCTACACGTATAAAGATATTTAGTGTGTCAGTGTAAATTCCCAAGCACGAATTTATGGGGTCAAATTTTGCTACACCATACATTGGAGTGGTCTCAGCTCGTTTGATGACTTTCTGGGTATCATATAGAAGAAACATGCCAAAAAGTACTAAGCCCCCATAAATGGCAATGGAGTAAAGGCCAGCGCCAAAAGCAGAAGTTGGAGGAAGAAACGCACTCCCTATGGAGGAAGCAAGGACAAGTCCCAGACCAACACCAAGAGGCCCTCCCATATTTAGAAACTTCTCACTTGGTGCACACATAGCCACAGTGGAAAGACCTCCAACAATTCCAGCTGTGTACCAAGCAGCTCTAATCAGCAGAGGGCCACCAAGCAAAGTCAATGGAGCAACCACTGCCCCCATCACTCCTGCATGCAACATCCATGCAAGATGTTTAGCTCCCGGGCTTTGATCATAGGATATAGAACGAACCAACATCCCAGCTCCAATCATTGCAGCAAAAGTTGCACCAATTGCCAGCCAGGAGCCTCTCATCATCAAGCTCATAAGAGCAGGTGACCTACTAACCGCCACAGCAGAGAGGGCTGTGAGGCCAATACTGCCAGCAAAATACATGTAGGTAGATCGAATTCTCTCTTTCACATACTGAGGGCCAAATACAAGCCTTAATCTATTGGAACCATTTTCAATTGGAACATTTCCCCAATCCCATAAAAAAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTCGTCTGTTTCCACCTC