ORFeome > gjb2 ORF1 – XORFeome v1.0

gjb2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gjb2
Gene ID: 955804
Gene Page ID: 955797
ORF Xenbase ID: 17277117

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043797
Original XGC clone length: 747

Human orthology & disease relationships

NCBI Entrez ID: 2706
Ensembl gene IDs: ENSG00000165474
Directly associated (OMIM) disease MIM numbers: 124500,148210,148350,149200,220290,601544,602540
Indirectly associated (Lage, et al.) disease MIM numbers: 601544

Library Location

Plate ID: GDExl11012
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ823974
dbEST ID: 79641676
Trimmed Sequence: ATGGATTGGGGAACGCTCTACGAGGTCATTGGAGGAGTGAACAGACACTCTACAAGCATCGGCAAGATCTGGCTCTCAGTTCTCTTCATCTTCCGCATTATGATTCTGGTCGTGGCTGCAGAGAGCGTGTGGGGGGACGAACAGTCCGATTTCACCTGCAACACCTTACAGCCCGGATGCAAGAACGTCTGCTACGACCATCACTTTCCAGTTTCTCACATCAGGTTGTGGTGCCTGCAACTTATATTTGTTGCTACCCCCGCCCTTTTGGTCGCTATGCACGTGGCTTATCTAAAACACGAAGAGAAGAGGCAGATGCAGAAGAAGGGGAACTGTGGAGGAAAGGACTTGGAGGAGCTGAAGCAAAGGAAGGTCAGAATCAGGGGAACCTTGTGGTGGACCTACACTACCAGCATCTTGTTCAGAGTCCTCTTTGAAGCTGCCTTTATGTACCTCTTCTACTATTTGTATTCCGGCTTCCACATGCCGAGGCTTGTGCAGTGCAACAACTGGCCTTGCCCCAACGTGGTCGACTGCTTCATTTCCAGGCCTACAGAANAGACCGTCTTCACTATATTCATGATTGTCGTGTCTGGCATCTGCATGGTTCTGAACGTCATGGAGGTTTGTTACCTAATCGTGCAGGCTTCCCTAAGGAGGTCAAG
Full Trace Sequence: CCATATTGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTGGGGAACGCTCTACGAGGTCATTGGAGGAGTGAACAGACACTCTACAAGCATCGGCAAGATCTGGCTCTCAGTTCTCTTCATCTTCCGCATTATGATTCTGGTCGTGGCTGCAGAGAGCGTGTGGGGGGACGAACAGTCCGATTTCACCTGCAACACCTTACAGCCCGGATGCAAGAACGTCTGCTACGACCATCACTTTCCAGTTTCTCACATCAGGTTGTGGTGCCTGCAACTTATATTTGTTGCTACCCCCGCCCTTTTGGTCGCTATGCACGTGGCTTATCTAAAACACGAAGAGAAGAGGCAGATGCAGAAGAAGGGGAACTGTGGAGGAAAGGACTTGGAGGAGCTGAAGCAAAGGAAGGTCAGAATCAGGGGAACCTTGTGGTGGACCTACACTACCAGCATCTTGTTCAGAGTCCTCTTTGAAGCTGCCTTTATGTACCTCTTCTACTATTTGTATTCCGGCTTCCACATGCCGAGGCTTGTGCAGTGCAACAACTGGCCTTGCCCCAACGTGGTCGACTGCTTCATTTCCAGGCCTACAGAANAGACCGTCTTCACTATATTCATGATTGTCGTGTCTGGCATCTGCATGGTTCTGAACGTCATGGAGGTTTGTTACCTAATCGTGCAGGCTTCCCTAAGGAGGTCAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTGGGGAACGCTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829283
dbEST ID: 79646985
Trimmed Sequence: ATGTTCTTTCTGTTCGTTCATGATGTTCTGCTTCTCCTCCTTTCCAGACATGTGGTTAGAATGCCTAAGTGTATTTTTTCTTGACCTCCTTAGGGAAGCCTGCACGATTAGGTAACAAACCTCCATGACGTTCAGAACCATGCAGATGCCAGACACGACAATCATGAATATAGTGAAGACGGTCTTTTCTGTAGGCCTGGAAATGAAGCAGTCGACCACGTTGGGGCAAGGCCAGTTGTTGCACTGCACAAGCCTCGGCATGTGGAAGCCGGAATACAAATAGTAGAAGAGGTACATAAAGGCAGCTTCAAAGAGGACTCTGAACAAGATGCTGGTAGTGTAGGTCCACCACAAGGTTCCCCTGATTCTGACCTTCCTTTGCTTCAGCTCCTCCAAGTCCTTTCCTCCACAGTTCCCCTTCTTCTGCATCTGCCTCTTCTCTTCGTGTTTTAGATAAGCCACGTGCATAGCGACCAAAAGGGCGGGGGTAGCAACAAATATAAGTTGCAGGCACCACAACCTGATGTGAGAAACTGGAAAGTGATGGTCGTAGCAGACGTTCTTGCATCCCGGCTGTAAGGTGTTGCAGGTGAAATCGGACTGTTCGTCCCCCCACACGCTTCCTGCAGCCCCGACCAAAATCAATAAGGCGGAAGAAGAAAAAAAACGAAAAACCAAATCTTGGCCGAATCCTTGTAGAAAGGGGTTGGTTTC
Full Trace Sequence: CCGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGTTCTTTCTGTTCGTTCATGATGTTCTGCTTCTCCTCCTTTCCAGACATGTGGTTAGAATGCCTAAGTGTATTTTTTCTTGACCTCCTTAGGGAAGCCTGCACGATTAGGTAACAAACCTCCATGACGTTCAGAACCATGCAGATGCCAGACACGACAATCATGAATATAGTGAAGACGGTCTTTTCTGTAGGCCTGGAAATGAAGCAGTCGACCACGTTGGGGCAAGGCCAGTTGTTGCACTGCACAAGCCTCGGCATGTGGAAGCCGGAATACAAATAGTAGAAGAGGTACATAAAGGCAGCTTCAAAGAGGACTCTGAACAAGATGCTGGTAGTGTAGGTCCACCACAAGGTTCCCCTGATTCTGACCTTCCTTTGCTTCAGCTCCTCCAAGTCCTTTCCTCCACAGTTCCCCTTCTTCTGCATCTGCCTCTTCTCTTCGTGTTTTAGATAAGCCACGTGCATAGCGACCAAAAGGGCGGGGGTAGCAACAAATATAAGTTGCAGGCACCACAACCTGATGTGAGAAACTGGAAAGTGATGGTCGTAGCAGACGTTCTTGCATCCCGGCTGTAAGGTGTTGCAGGTGAAATCGGACTGTTCGTCCCCCCACACGCTTCCTGCAGCCCCGACCAAAATCAATAAGGCGGAAGAAGAAAAAAAACGAAAAACCAAATCTTGGCCGAATCCTTGTAGAAAGGGGTTGGTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTTCTTTCTGTTCGTTCATGAT