ORFeome > gjb7 ORF1 – XORFeome v1.0

gjb7 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gjb7
Gene ID: 965096
Gene Page ID: 965092
ORF Xenbase ID: 17277129

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC055269
Original XGC clone length: 744

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ839580
dbEST ID: 79657282
Trimmed Sequence: ATGAGTTGGTCATTTTTGCGTGATATCTTGAGCGGAGTAAATAAATATTCCACAAGCATTGGAAGAATCTGGCTTTCAATTGTGTTCATATTTCGACTATTGGTCTATGTTGTTGCAGCCGAAGCAGTGTGGAAAGATGAACAGAAAGAATTTGAGTGCAACATCAGACAGCCTGGGTGTGAAAACGTTTGCTTCGATCAGTTCTTCCCCATCTCCCAGGTGCGGCTCTGGGCTTTACAGCTGATTATGGTGTCAACACCCTCGCTTCTTGTTGTTCTTCATGTTGCCTATCGGGAAAGTAGGGAGAAGAGGCACAACAAGAAGCTGTATGCCAACACTGGAGACATGGATGGGGGATTATGGTGCACATATGTCATAAGCCTTTTCTTCAAGACGATATTTGAATTTGGCTTTCTTTTACTTTTCTACAAACTGTATGGGGGTTTCAGTGTACCTCGACTGGTGAAATGTGACATGGAACCCTGCCCTAATGTTGTGGACTGCTATATCTCCCAACCTACAGAGAAGATGATTTTTCTGTATTTTGTGGTTGTAACCTCAGGACTTTGCATTTTGCTTAATGTTAGTGAGCTTTTTTACTTTATTTCGAGTGTTGGACAAAATTCTACCTGAAAAAACAAGCGAACGACAAGGGGCGCGGAAGGCTGTGAATTGGAGGAAGCGAGCAGCAGAGCGGAAACGAGTTGGAGATTAACAGGCCAAGCAATGAGGCGCCCAGAAGGGTTGCCCACGTTTTCTGTTTAAAAAATTGGACATATAAAAAA
Full Trace Sequence: TCGAGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTGGTCATTTTTGCGTGATATCTTGAGCGGAGTAAATAAATATTCCACAAGCATTGGAAGAATCTGGCTTTCAATTGTGTTCATATTTCGACTATTGGTCTATGTTGTTGCAGCCGAAGCAGTGTGGAAAGATGAACAGAAAGAATTTGAGTGCAACATCAGACAGCCTGGGTGTGAAAACGTTTGCTTCGATCAGTTCTTCCCCATCTCCCAGGTGCGGCTCTGGGCTTTACAGCTGATTATGGTGTCAACACCCTCGCTTCTTGTTGTTCTTCATGTTGCCTATCGGGAAAGTAGGGAGAAGAGGCACAACAAGAAGCTGTATGCCAACACTGGAGACATGGATGGGGGATTATGGTGCACATATGTCATAAGCCTTTTCTTCAAGACGATATTTGAATTTGGCTTTCTTTTACTTTTCTACAAACTGTATGGGGGTTTCAGTGTACCTCGACTGGTGAAATGTGACATGGAACCCTGCCCTAATGTTGTGGACTGCTATATCTCCCAACCTACAGAGAAGATGATTTTTCTGTATTTTGTGGTTGTAACCTCAGGACTTTGCATTTTGCTTAATGTTAGTGAGCTTTTTTACTTTATTTCGAGTGTTGGACAAAATTCTACCTGAAAAAACAAGCGAACGACAAGGGGCGCGGAAGGCTGTGAATTGGAGGAAGCGAGCAGCAGAGCGGAAACGAGTTGGAGATTAACAGGCCAAGCAATGAGGCGCCCAGAAGGGTTGCCCACGTTTTCTGTTTAAAAAATTGGACATATAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTGGTCATTTTTGCGTGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ839579
dbEST ID: 79657281
Trimmed Sequence: ACCATCAGGTGCACCATTGCCTGCCTGTTCATATGTAATTGGTATTACATTATGTTGGTGGTTCTTGCAATCACAGCTTGCTTGCGCCATTCTGGTTGCTTGTTTTTTCATGTAGAATTTTGTACAATATTTGAAAATAAGGTAAAATAGCTCACTAACATTAAGCAAAATGCAAAGCCCTGAGGTTACAACCACAAAATACAGAAAAATCATCTTCTCTGTAGGTTTGGAGATATAGCAGTCCACAACATTANGGCAGGGTTCCATGTCACATTTCACCAGTCGAGGTACACTGAAACCCCCATACAGTTTGTAGAAAAAGTAAAAGAAAGCCAAAATCAAATATCGTCTTTGAAAAAAAGGCTTATGAACATATGTGCACCATACTCCCCCATCCTTGTCTTCCCGTGGTGGGCATACAGCTTTCTTGTTTTTGCCTCCTCTTCCCAAACTTTCCCAAAAGGCAACATGAGAAAAAAACAAAAAACCGAGGGTTTTTAACACCATAACTCCCCCTTAAAACCCCAAAACCCCCACCGGGGAAAAGGGAAAAAAAACAAAAACAAAAACAAACTTTTTTCCAACCCCCCGCTTTTTCGAAGTTTCACTCCAAAATCTTTTTTGGTTCACTTTTTCCCCCCTGGCTCGCGGCGGGACAAAAAAAAAAAACAAATTGCCCAAAATATAAAAAAAAAATTTTAAAACCACAAATACTCCCCCCAAGTGGGGGGGGGGAAAAATTTTATTTTCTCTCCCCCTTCTAAAATAATACACAAACAAAAAAAA
Full Trace Sequence: GAAGATGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCATCAGGTGCACCATTGCCTGCCTGTTCATATGTAATTGGTATTACATTATGTTGGTGGTTCTTGCAATCACAGCTTGCTTGCGCCATTCTGGTTGCTTGTTTTTTCATGTAGAATTTTGTACAATATTTGAAAATAAGGTAAAATAGCTCACTAACATTAAGCAAAATGCAAAGCCCTGAGGTTACAACCACAAAATACAGAAAAATCATCTTCTCTGTAGGTTTGGAGATATAGCAGTCCACAACATTANGGCAGGGTTCCATGTCACATTTCACCAGTCGAGGTACACTGAAACCCCCATACAGTTTGTAGAAAAAGTAAAAGAAAGCCAAAATCAAATATCGTCTTTGAAAAAAAGGCTTATGAACATATGTGCACCATACTCCCCCATCCTTGTCTTCCCGTGGTGGGCATACAGCTTTCTTGTTTTTGCCTCCTCTTCCCAAACTTTCCCAAAAGGCAACATGAGAAAAAAACAAAAAACCGAGGGTTTTTAACACCATAACTCCCCCTTAAAACCCCAAAACCCCCACCGGGGAAAAGGGAAAAAAAACAAAAACAAAAACAAACTTTTTTCCAACCCCCCGCTTTTTCGAAGTTTCACTCCAAAATCTTTTTTGGTTCACTTTTTCCCCCCTGGCTCGCGGCGGGACAAAAAAAAAAAACAAATTGCCCAAAATATAAAAAAAAAATTTTAAAACCACAAATACTCCCCCCAAGTGGGGGGGGGGAAAAATTTTATTTTCTCTCCCCCTTCTAAAATAATACACAAACAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCATCAGGTGCACCATT